Metadata-Version: 1.1
Name: mpwt
Version: 0.5
Summary: Multiprocessing for Pathway Tools
Home-page: https://github.com/AuReMe/mpwt
Author: A. Belcour
Author-email: arnaud.belcour@gmail.com
License: UNKNOWN
Description: .. image:: https://img.shields.io/pypi/v/mpwt.svg
        	:target: https://pypi.python.org/pypi/mpwt
        
        mpwt: Pathway Tools multiprocessing wrapper
        ===========================================
        
        mpwt is a python package for running Pathway Tools on multiple genomes using multiprocessing.
        
        There is no guarantee that this script will work, it is a Work In Progress in early state.
        
        .. contents:: Table of contents
           :backlinks: top
           :local:
        
        Installation
        ------------
        
        Requirements
        ~~~~~~~~~~~~
        
        mpwt works only on **Python 3** and it has been tested on Python 3.6.
        It requires some python packages (biopython, docopt and gffutils) and **Pathway Tools**.
        
        You must have an environment where Pathway Tools is installed. Pathway Tools can be obtained `here <http://bioinformatics.ai.sri.com/ptools/>`__.
        For some versions you need to have Blast installed on you system, for further informations look at `this page <http://bioinformatics.ai.sri.com/ptools/installation-guide/released/blast.html>`__.
        
        If your OS doesn't support Pathway Tools, you can use a docker. If it's your case, look at `Pathway Tools Multiprocessing Docker <https://github.com/ArnaudBelcour/mpwt-docker>`__.
        It is a dockerfile that will create a container with Pathway Tools, its dependencies and this package. You just need to give a Pathway Tools installer as input.
        
        You can also look at `Pathway Tools Multiprocessing Singularity <https://github.com/ArnaudBelcour/mpwt-singularity>`__.
        More manipulations are required compared to Docker but with this you can create a Singularity image.
        
        Using pip
        ~~~~~~~~~
        
        .. code:: sh
        
        	pip install mpwt
        
        Use
        ---
        
        Input data
        ~~~~~~~~~~
        
        The script takes a folder containing sub-folders as input. Each sub-folder contains a Genbank/GFF file or multiple PathoLogic Format (PF) files.
        
        .. code-block:: text
        
            Folder_input
            ├── species_1
            │   └── species_1.gbk
            ├── species_2
            │   └── species_2.gff
            │   └── species_2.fasta
            ├── species_3
            │   └── species_3.gbk
            ├── species_4
            │   └── scaffold_1.pf
            │   └── scaffold_1.fasta
            │   └── scaffold_2.pf
            │   └── scaffold_2.fasta
            taxon_id.tsv
            ..
        
        Genbank files must have the same name as the folder in which they are located and also finished with a .gbk or a .gff.
        
        For PF files, there is one file for each scaffold/contig and one corresponding fasta file.
        
        Pathway Tools will run on each Genbank/GFF/PF files. It will create the results in the ptools-local folder but you can also choose an output folder.
        
        Genbank
        +++++++
        
        Genbank file example:
        
        .. code-block:: text
        
            LOCUS       scaffold1         XXXXXX bp    DNA     linear   INV DD-MMM-YYYY
            DEFINITION  My species genbank.
            ACCESSION   scaffold1
            VERSION     scaffold1
            KEYWORDS    Key words.
            SOURCE      Source
            ORGANISM  Species name
                        Taxonomy; Of; My; Species; With;
                        The; Genus.
            FEATURES             Location/Qualifiers
                source          1..XXXXXX
                                /scaffold="scaffold1"
                                /db_xref="taxon:taxonid"
                gene            START..STOP
                                /locus_tag="gene1"
                mRNA            START..STOP
                                /locus_tag="gene1"
                CDS             START..STOP
                                /locus_tag="gene1"
                                /db_xref="InterPro:IPRXXXXXX"
                                /go_component="GO:XXXXXXX"
                                /EC_number="X.X.X.X"
                                /translation="AMINOAACIDSSEQUENCE"
        
        Look at the `NCBI GBK format <http://www.insdc.org/files/feature_table.html#7.1.2>`__ for more informations.
        You can also look at the `example <http://bioinformatics.ai.sri.com/ptools/sample.gbff>`__ provided on Pathway Tools site.
        
        GFF
        +++
        
        GFF file example:
        
        .. code-block:: text
        
            ##gff-version 3
            ##sequence-region scaffold_1 1 XXXXXX
            scaffold_1	RefSeq	region	1	XXXXXXX	.	+	.	ID=region_id;Dbxref=taxon:XXXXXX
            scaffold_1	RefSeq	gene	START	STOP	.	-	.	ID=gene_id
            scaffold_1	RefSeq	CDS	START	STOP	.	-	0	ID=cds_id;Parent=gene_id
        
        **Warning**: it seems that metabolic networks from GFF file have less reactions/pathways/compounds than metabolic networks from Genbank file.
        Lack of some annotations (EC, GO) can be the reason explaining these differences.
        
        Look at the `NCBI GFF format <https://www.ncbi.nlm.nih.gov/genbank/genomes_gff/>`__ for more informations.
        
        You have to provide a nucleotide sequence file associated with the GFF file containing the chromosome/scaffold/contig sequence.
        
        .. code-block:: text
        
            >scaffold_1
            ATGATGCTGATACTGACTTAGCAT
        
        PathoLogic Format
        +++++++++++++++++
        
        PF file example:
        
        .. code-block:: text
        
            ;;;;;;;;;;;;;;;;;;;;;;;;;
            ;; scaffold_1
            ;;;;;;;;;;;;;;;;;;;;;;;;;
            ID	gene_id
            NAME	gene_id
            STARTBASE	START
            ENDBASE	STOP
            FUNCTION	ORF
            PRODUCT-TYPE	P
            PRODUCT-ID	prot gene_id
            EC	X.X.X.X
            DBLINK	GO:XXXXXXX
            INTRON	START1-STOP1
            //
        
        Look at the `Pathologic format <http://bioinformatics.ai.sri.com/ptools/tpal.pf/>`__ for more informations.
        
        You have to provide one nucleotide sequence for each pathologic containing one scaffold/contig.
        
        .. code-block:: text
        
            >scaffold_1
            ATGATGCTGATACTGACTTAGCAT
        
        Also to add the taxon ID we need the **taxon_id.tsv** (a tsv file with two values: the name of the folder containing the PF files and the taxon ID corresponding).
        
        +------------+------------+
        |species     |taxon_id    |
        +============+============+
        |species_4   |4           |
        +------------+------------+
        
        If you don't have taxon ID in your Genbank or GFF file, you can add one in this file for the corresponding species.
        
        Input files created by mpwt
        ~~~~~~~~~~~~~~~~~~~~~~~~~~~
        
        Three input files are created by mpwt. Informations are extracted from the Genbank/GFF/PF file.
        myDBName corresponds to the name of the folder and the Genbank/GFF/PF file.
        taxonid corresponds to the taxonid in the db_xref of the source feature in the Genbank/GFF/PF.
        species_name is extracted from the Genbank/GFF/PF files.
        
        .. code-block:: text
        
            **organism-params.dat**
            ID  myDBName
            STORAGE FILE
            NCBI-TAXON-ID   taxonid
            NAME    species_name
        
            **genetic-elements.dats**
            NAME    
            ANNOT-FILE  gbk_pathname
            //
        
            **dat_creation.lisp**
            (in-package :ecocyc)
            (select-organism :org-id 'myDBName)
            (let ((*progress-noter-enabled?* NIL))
                    (create-flat-files-for-current-kb))
        
        Command Line and Python arguments
        ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
        
        mpwt can be used with the command line:
        
        .. code:: sh
        
            mpwt -f path/to/folder/input [-o path/to/folder/output] [--patho] [--hf] [--dat] [--md] [--cpu INT] [-r] [--clean] [--log path/to/folder/log] [--ignore-error] [-v]
        
        Optional argument are identified by [].
        
        mpwt can be used in a python script with an import:
        
        .. code:: python
        
            import mpwt
        
            folder_input = "path/to/folder/input"
            folder_output = "path/to/folder/output"
        
            mpwt.multiprocess_pwt(folder_input=string,
        			  folder_output=string,
        			  patho_inference=optional_boolean,
        			  patho_hole_filler=optional_boolean,
        			  dat_creation=optional_boolean,
        			  dat_extraction=optional_boolean,
        			  size_reduction=optional_boolean,
        			  number_cpu=int,
        			  patho_log=optional_folder_pathname,
        			  ignore_error=optional_boolean,
        			  taxon_file=optional_boolean,
        			  verbose=optional_boolean)
        
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        | Command line argument   | Python argument                                | description                                                             |
        +=========================+================================================+=========================================================================+
        |          -f             | folder_input(string: folder pathname)          | input folder as described in Input data                                 |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          -o             | folder_output(string: folder pathname)         | output folder containing PGDB data or dat files (see --dat arguments)   |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          --patho        | patho_inference(boolean)                       | launch PathoLogic inference on input folder                             |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          --hf           | patho_hole_filler(boolean)                     | launch PathoLogic Hole Filler with Blast                                |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          --dat          | dat_creation(boolean)                          | Create BioPAX/attribute-value dat files                                 |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          --md           | dat_extraction(boolean)                        | Move only the dat files inside the output folder                        |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          --cpu          | number_cpu(int)                                | Number of cpu used for the multiprocessing                              |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          -r             | size_reduction(boolean)                        | Delete PGDB in ptools-local to reduce size and return compressed files  |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          --log          | patho_log(string: folder pathname)             | Folder where log files for PathoLogic inference will be store           |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          --delete       | mpwt.remove_pgdbs(string: pgdb name)           | Delete a specific PGDB                                                  |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          --clean        | mpwt.cleaning()                                | Delete all PGDBs in ptools-local folder or only PGDB from input folder  |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |     --ignore-error      | ignore_error(boolean)                          | Ignore errors and continue the workflow for successful build            |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |     --taxon-file        | taxon_file(boolean)                            | Force mpwt to use the taxon ID in the taxon_id.tsv file                 |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        |          -v             | verbose(boolean)                               | Print some information about the processing of mpwt                     |
        +-------------------------+------------------------------------------------+-------------------------------------------------------------------------+
        
        Examples
        ~~~~~~~~
        
        Possible uses of mpwt:
        
        ..
        
            .. code:: sh
        
                command line
        
            .. code:: python
        
                import mpwt
                python script
        
        Create PGDBs of studied organisms inside ptools-local:
        
        ..
        
            .. code:: sh
        
                mpwt -f path/to/folder/input --patho
        
            .. code:: python
        
                import mpwt
                mpwt.multiprocess_pwt(input_folder='path/to/folder/input',
                        patho_inference=True)
        
        Create PGDBs of studied organisms inside ptools-local with the Hole-Filler:
        
        ..
        
            .. code:: sh
        
                mpwt -f path/to/folder/input --patho --hf --log path/to/folder/log
        
            .. code:: python
        
                import mpwt
                mpwt.multiprocess_pwt(input_folder='path/to/folder/input',
                        patho_inference=True,
                        patho_hole_filler=True,
                        patho_log='path/to/folder/log')
        
        Create PGDBs of studied organisms inside ptools-local and create dat files:
        
        ..
        
            .. code:: sh
        
                mpwt -f path/to/folder/input --patho --dat
        
            .. code:: python
        
                import mpwt
                mpwt.multiprocess_pwt(input_folder='path/to/folder/input',
                        patho_inference=True,
                                    dat_creation=True)
        
        Create PGDBs of studied organisms inside ptools-local.
        Then move the files to the output folder.
        
        ..
        
            .. code:: sh
        
                mpwt -f path/to/folder/input --patho -o path/to/folder/output
        
            .. code:: python
        
                import mpwt
                mpwt.multiprocess_pwt(input_folder='path/to/folder/input',
                                    folder_output='path/to/folder/output',
                        patho_inference=True)
        
        Create PGDBs of studied organisms inside ptools-local and create dat files.
        Then move the dat files to the output folder.
        
        ..
        
            .. code:: sh
        
                mpwt -f path/to/folder/input --patho --dat -o path/to/folder/output --md
        
        
            .. code:: python
        
                import mpwt
                mpwt.multiprocess_pwt(input_folder='path/to/folder/input',
                                    folder_output='path/to/folder/output',
                        patho_inference=True,
                                    dat_creation=True,
                        dat_extraction=True)
        
        
        Create dat files for the PGDB inside ptools-local.
        And move them to the output folder.
        
        ..
        
            .. code:: sh
        
                mpwt --dat -o path/to/folder/output --md
        
            .. code:: python
        
                import mpwt
                mpwt.multiprocess_pwt(folder_output='path/to/folder/output',
                                    dat_creation=True,
                        dat_extraction=True)
        
        Move PGDB from ptools-local to the output folder:
        
        ..
        
            .. code:: sh
        
                mpwt -o path/to/folder/output
        
            .. code:: python
        
                import mpwt
                mpwt.multiprocess_pwt(folder_output='path/to/folder/output')
        
        Move dat files from ptools-local to the output folder:
        
        ..
        
            .. code:: sh
        
                mpwt -o path/to/folder/output --md
        
            .. code:: python
        
                import mpwt
                mpwt.multiprocess_pwt(folder_output='path/to/folder/output',
                        dat_extraction=True)
        
        
        Useful functions
        ~~~~~~~~~~~~~~~~
        
        - Run the multiprocess Pathway Tools on input folder
        
        ..
        
            .. code:: python
        
                import mpwt
                mpwt.multiprocess_pwt(folder_input,
                                      folder_output,
                                      patho_inference=optional_boolean,
                                      dat_creation=optional_boolean,
                                      dat_extraction=optional_boolean,
                                      size_reduction=optional_boolean,
                                      number_cpu=int,
                                      verbose=optional_boolean)
        
        - Delete all the previous PGDB and the metadata files
        
        ..
        
            .. code:: python
        
                import mpwt
                mpwt.cleaning()
        
            This can also be used with a command line argument:
        
            .. code:: sh
        
                mpwt --clean
        
            If you use clean and the argument -f input_folder, it will delete input files ('dat_creation.lisp', 'pathologic.log', 'genetic-elements.dat' and 'organism-params.dat') and the PGDB corresponding to the input folder.
        
            .. code:: sh
        
                mpwt -f input_folder --clean
        
            For example if you have:
        
            .. code-block:: text
        
                Folder_input
                ├── species_1
                │   └── species_1.gbk
                ├── species_2
                │   └── species_2.gff
                │   └── species_2.fasta
                ├── species_3
                │   └── species_3.gbk
        
            And you have in your ptools-local:
        
            .. code-block:: text
        
                ptools-local
                ├── pgdbs
                    ├── user
                        ├── species_1cyc
                        │   └── ..
                        ├── species_2cyc
                        │   └── ..
                        ├── species_3cyc
                        │   └── ..
                        ├── species_4cyc
                        │   └── ..
        
            The command:
        
            .. code:: sh
        
                mpwt -f input_folder --clean
        
            will delete species_1cyc, species_2cyc and species_3cyc but not species_4cyc.
        
        - Delete a specific PGDB
        
        ..
        
            With this command, it is possible to delete a specified db, where pgdb_name is the name of the PGDB (ending with 'cyc'). It can be multiple pgdbs, to do this, put all the pgdb IDs in a string separated by  a ','.
        
            .. code:: python
        
                import mpwt
                mpwt.remove_pgdbs(pgdb_name)
        
            And as a command line:
        
            .. code:: sh
        
                mpwt --delete mydbcyc1,mydbcyc2
        
        - Return the path of ptools-local
        
        ..
        
            .. code:: python
        
                import mpwt
                ptools_local_path = mpwt.find_ptools_path()
        
        
        - Return a list containing all the PGDBs inside ptools-local folder
        
        ..
        
            .. code:: python
        
                import mpwt
                list_of_pgdbs = mpwt.list_pgdb()
        
            Can be used as a command with:
        
            .. code:: sh
        
                mpwt --list
        
        Errors
        ~~~~~~
        
        If you encounter errors (and it is highly possible) there is some tips that can help you resolved them.
        
        For error during PathoLogic inference, you can use the log arguments.
        The log contains the summary of the build and the error for each species.
        There is also a pathologic.log in each sub-folders.
        
        If the build passed you have also the possibility to see the result of the inference with the file resume_inference.tsv.
        For each species, it contains the number of genes/proteins/reactions/pathways/compounds in the metabolic network.
        
        If Pathway Tools crashed, mpwt can print some useful information in verbose mode.
        It will show the terminal in which Pathway Tools has crashed.
        Also, if there is an error in pathologic.log, it will be shown after **=== Error in Pathologic.log ===**.
        
        You can also ignore PathoLogic errors by using the argument --ignore-error/ignore_error.
        This option will ignore error and continue the mpwt workflow on the successful PathoLogic build.
        
        Output
        ~~~~~~
        
        If you did not use the output argument, results (PGDB with/without BioPAX/dat files) will be inside your ptools-local folder ready to be used with Pathway Tools.
        Have in mind that mpwt does not create the cellular overview and does not used the hole-filler. So if you want these results you should run them after.
        
        If you used the output argument, there is two potential outputs depending on the use of the option **--md/dat_extraction**:
        
        - without --md/dat_extraction, you will have a complete PGDB folder inside your results, for example:
        
        .. code-block:: text
        
            Folder_output
            ├── species_1
            │   └── default-version
            │   └── 1.0
            │       └── data
            │           └── contains BioPAX/dat files if you used the --dat/dat_creation option.
            │       └── input
            │           └── species_1.gbk
            │           └── genetic-elements.dat
            │           └── organism-init.dat
            │           └── organism.dat
            │       └── kb
            │           └── species_1.ocelot
            │       └── reports
            │           └── contains Pathway Tools reports.
            ├── species_2
            ..
            ├── species_3
            ..
        
        - with --md/dat_extraction, you will only have the dat files, for example:
        
        .. code-block:: text
        
            Folder_output
            ├── species_1
            │   └── classes.dat
            │   └── compounds.dat
            │   └── dnabindsites.dat
            │   └── enzrxns.dat
            │   └── genes.dat
            │   └── pathways.dat
            │   └── promoters.dat
            │   └── protein-features.dat
            │   └── proteins.dat
            │   └── protligandcplxes.dat
            │   └── pubs.dat
            │   └── reactions.dat
            │   └── regulation.dat
            │   └── regulons.dat
            │   └── rnas.dat
            │   └── species.dat
            │   └── terminators.dat
            │   └── transunits.dat
            │   └── ..
            ├── species_2
            ..
            ├── species_3
            ..
        
        - with the **-r /size_reduction** argument, you will have compressed zip files (and PGDBs inside ptools-local will be deleted):
        
        .. code-block:: text
        
            Folder_output
            ├── species_1.zip
            ├── species_2.zip
            ├── species_3.zip
            ..
        
        Release Notes
        -------------
        
        Changes between version are listed on the `release page <https://github.com/AuReMe/mpwt/releases>`__.
        
        Acknowledgements
        ----------------
        
        `Mézaine Aite <https://github.com/mezianeAITE>`__ for his work on the first draft of this package.
        
        `Clémence Frioux <https://github.com/cfrioux>`__ for her work and feedbacks.
        
        Peter Karp, Suzanne Paley, Markus Krummenacker, Richard Billington and Anamika Kothari from the Bioinformatics Research Group of SRI International for their help on Pathway Tools and on Genbank format.
        
        GenOuest bioinformatics (https://www.genouest.org/) core facility for providing the computing infrastructure to test this tool.
        
        All the users that have tested this tool.
        
Platform: UNKNOWN
Classifier: Development Status :: 4 - Beta
Classifier: Intended Audience :: Science/Research
Classifier: Intended Audience :: Developers
Classifier: Programming Language :: Python :: 3
