Metadata-Version: 2.1
Name: graphein
Version: 1.0.0
Summary: Protein & Interactomic Graph Construction for Machine Learning
Home-page: https://github.com/a-r-j/graphein
Author: Arian Jamasb
Author-email: arian@jamasb.io
License: MIT
Platform: any
Classifier: License :: OSI Approved :: MIT License
Classifier: Development Status :: 5 - Production/Stable
Classifier: Operating System :: Microsoft :: Windows
Classifier: Operating System :: POSIX
Classifier: Operating System :: Unix
Classifier: Operating System :: MacOS
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.5
Classifier: Programming Language :: Python :: 3.6
Classifier: Programming Language :: Python :: 3.7
Classifier: Topic :: Scientific/Engineering
Requires-Python: >=3.7
Description-Content-Type: text/markdown
License-File: LICENSE
Requires-Dist: biopandas
Requires-Dist: biopython
Requires-Dist: bioservices
Requires-Dist: matplotlib
Requires-Dist: multipledispatch
Requires-Dist: networkx
Requires-Dist: numpy
Requires-Dist: pandas
Requires-Dist: plotly
Requires-Dist: pydantic
Requires-Dist: pyyaml
Requires-Dist: sklearn
Requires-Dist: scipy
Requires-Dist: tqdm
Requires-Dist: wget
Requires-Dist: xarray
Provides-Extra: all
Requires-Dist: nbval ; extra == 'all'
Requires-Dist: pytest-xdist ; extra == 'all'
Requires-Dist: nbstripout ; extra == 'all'
Requires-Dist: sphinx ; extra == 'all'
Requires-Dist: sphinx-rtd-theme ; extra == 'all'
Requires-Dist: isort ; extra == 'all'
Requires-Dist: pytest ; extra == 'all'
Requires-Dist: black ; extra == 'all'
Requires-Dist: flake8 ; extra == 'all'
Requires-Dist: pre-commit ; extra == 'all'
Requires-Dist: nbsphinx-link ; extra == 'all'
Requires-Dist: pytest-cov ; extra == 'all'
Requires-Dist: furo ; extra == 'all'
Requires-Dist: interrogate ; extra == 'all'
Requires-Dist: pycodestyle ; extra == 'all'
Requires-Dist: nbsphinx ; extra == 'all'
Requires-Dist: hypothesis ; extra == 'all'
Requires-Dist: pandoc ; extra == 'all'
Requires-Dist: pydocstyle ; extra == 'all'
Provides-Extra: dev
Requires-Dist: black ; extra == 'dev'
Requires-Dist: flake8 ; extra == 'dev'
Requires-Dist: furo ; extra == 'dev'
Requires-Dist: hypothesis ; extra == 'dev'
Requires-Dist: interrogate ; extra == 'dev'
Requires-Dist: isort ; extra == 'dev'
Requires-Dist: nbsphinx ; extra == 'dev'
Requires-Dist: nbsphinx-link ; extra == 'dev'
Requires-Dist: sphinx-rtd-theme ; extra == 'dev'
Requires-Dist: nbstripout ; extra == 'dev'
Requires-Dist: nbval ; extra == 'dev'
Requires-Dist: pandoc ; extra == 'dev'
Requires-Dist: pre-commit ; extra == 'dev'
Requires-Dist: pycodestyle ; extra == 'dev'
Requires-Dist: pydocstyle ; extra == 'dev'
Requires-Dist: pytest ; extra == 'dev'
Requires-Dist: pytest-cov ; extra == 'dev'
Requires-Dist: pytest-xdist ; extra == 'dev'
Requires-Dist: sphinx ; extra == 'dev'
Provides-Extra: extras
Requires-Dist: black ; extra == 'extras'
Requires-Dist: flake8 ; extra == 'extras'
Requires-Dist: furo ; extra == 'extras'
Requires-Dist: hypothesis ; extra == 'extras'
Requires-Dist: interrogate ; extra == 'extras'
Requires-Dist: isort ; extra == 'extras'
Requires-Dist: nbsphinx ; extra == 'extras'
Requires-Dist: nbsphinx-link ; extra == 'extras'
Requires-Dist: sphinx-rtd-theme ; extra == 'extras'
Requires-Dist: nbstripout ; extra == 'extras'
Requires-Dist: nbval ; extra == 'extras'
Requires-Dist: pandoc ; extra == 'extras'
Requires-Dist: pre-commit ; extra == 'extras'
Requires-Dist: pycodestyle ; extra == 'extras'
Requires-Dist: pydocstyle ; extra == 'extras'
Requires-Dist: pytest ; extra == 'extras'
Requires-Dist: pytest-cov ; extra == 'extras'
Requires-Dist: pytest-xdist ; extra == 'extras'
Requires-Dist: sphinx ; extra == 'extras'



[![Docs](https://assets.readthedocs.org/static/projects/badges/passing-flat.svg)](http://www.graphein.ai)
[![DOI:10.1101/2020.07.15.204701](https://zenodo.org/badge/DOI/10.1101/2020.07.15.204701.svg)](https://doi.org/10.1101/2020.07.15.204701)
[![Project Status: Active – The project has reached a stable, usable state and is being actively developed.](https://www.repostatus.org/badges/latest/active.svg)](https://www.repostatus.org/#active)
    <a href="https://github.com/badges/shields/pulse" alt="Activity">
[![CodeFactor](https://www.codefactor.io/repository/github/a-r-j/graphein/badge)](https://www.codefactor.io/repository/github/a-r-j/graphein)
[![Quality Gate Status](https://sonarcloud.io/api/project_badges/measure?project=a-r-j_graphein&metric=alert_status)](https://sonarcloud.io/dashboard?id=a-r-j_graphein)
[![Bugs](https://sonarcloud.io/api/project_badges/measure?project=a-r-j_graphein&metric=bugs)](https://sonarcloud.io/dashboard?id=a-r-j_graphein)
[![Maintainability Rating](https://sonarcloud.io/api/project_badges/measure?project=a-r-j_graphein&metric=sqale_rating)](https://sonarcloud.io/dashboard?id=a-r-j_graphein)
[![Reliability Rating](https://sonarcloud.io/api/project_badges/measure?project=a-r-j_graphein&metric=reliability_rating)](https://sonarcloud.io/dashboard?id=a-r-j_graphein)
[![Gitter chat](https://badges.gitter.im/gitterHQ/gitter.png)](https://gitter.im/graphein)
[![License: MIT](https://img.shields.io/badge/License-MIT-yellow.svg)](https://opensource.org/licenses/MIT)
<a href="https://github.com/psf/black"><img alt="Code style: black" src="https://img.shields.io/badge/code%20style-black-000000.svg"></a>
[![banner](docs/source/_static/graphein.png)](http://www.graphein.ai)


[Documentation](http://www.graphein.ai) | [Paper](https://www.biorxiv.org/content/10.1101/2020.07.15.204701v1) | [Tutorials](http://graphein.ai/notebooks_index.html)  

Protein & Interactomic Graph Library

This package provides functionality for producing geometric representations of protein and RNA structures, and biological interaction networks. We provide compatibility with standard PyData formats, as well as graph objects designed for ease of use with popular deep learning libraries.

## What's New?
* [Protein Graph Creation from AlphaFold2!](http://graphein.ai/notebooks/alphafold_protein_graph_tutorial.html)
* [Protein Graph Visualisation!](http://graphein.ai/notebooks/protein_mesh_tutorial.html)
* [RNA Graph Construction from Dotbracket notation](http://graphein.ai/modules/graphein.rna.html)
* [Protein - Protein Interaction Network Support & Structural Interactomics (Using AlphaFold2!)](http://graphein.ai/notebooks/ppi_tutorial.html)
* [High and Low-level API for massive flexibility - create your own bespoke workflows!](http://graphein.ai/notebooks/residue_graphs.html)

## Example usage
### Creating a Protein Graph
[Tutorial (Residue-level)](http://graphein.ai/notebooks/residue_graphs.html) | [Tutorial - Atomic](http://graphein.ai/notebooks/atom_graph_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.protein.html#module-graphein.protein.graphs)
```python
from graphein.protein.config import ProteinGraphConfig
from graphein.protein.graphs import construct_graph

config = ProteinGraphConfig()
g = construct_graph(config=config, pdb_code="3eiy")
```

### Creating a Protein Graph from the AlphaFold Protein Structure Database
[Tutorial](http://graphein.ai/notebooks/alphafold_protein_graph_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.protein.html#module-graphein.protein.graphs)
```python
from graphein.protein.config import ProteinGraphConfig
from graphein.protein.graphs import construct_graph
from graphein.protein.utils import download_alphafold_structure

config = ProteinGraphConfig()
fp = download_alphafold_structure("Q5VSL9", aligned_score=False)
g = construct_graph(config=config, pdb_path=fp)
```

### Creating a Protein Mesh
[Tutorial](http://graphein.ai/notebooks/protein_mesh_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.protein.html#module-graphein.protein.meshes)
```python
from graphein.protein.config import ProteinMeshConfig
from graphein.protein.meshes import create_mesh

verts, faces, aux = create_mesh(pdb_code="3eiy", config=config)
```
### Creating an RNA Graph
Tutorial | [Docs](http://graphein.ai/modules/graphein.rna.html)
```python
from graphein.rna.graphs import construct_rna_graph
# Build the graph from a dotbracket & optional sequence
rna = construct_rna_graph(dotbracket='..(((((..(((...)))..)))))...',
                          sequence='UUGGAGUACACAACCUGUACACUCUUUC')
```

### Creating a Protein-Protein Interaction Graph
[Tutorial](http://graphein.ai/notebooks/ppi_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.ppi.html)
```python
from graphein.ppi.config import PPIGraphConfig
from graphein.ppi.graphs import compute_ppi_graph
from graphein.ppi.edges import add_string_edges, add_biogrid_edges

config = PPIGraphConfig()
protein_list = ["CDC42", "CDK1", "KIF23", "PLK1", "RAC2", "RACGAP1", "RHOA", "RHOB"]

g = compute_ppi_graph(config=config,
                      protein_list=protein_list,
                      edge_construction_funcs=[add_string_edges, add_biogrid_edges]
                     )
```

### Creating a Gene Regulatory Network Graph
[Tutorial](http://graphein.ai/notebooks/grn_tutorial.html) | [Docs](http://graphein.ai/modules/graphein.grn.html)
```python
from graphein.grn.config import GRNGraphConfig
from graphein.grn.graphs import compute_grn_graph
from graphein.grn.edges import add_regnetwork_edges, add_trrust_edges

config = GRNGraphConfig()
gene_list = ["AATF", "MYC", "USF1", "SP1", "TP53", "DUSP1"]

g = compute_grn_graph(
    gene_list=gene_list,
    edge_construction_funcs=[
        partial(add_trrust_edges, trrust_filtering_funcs=config.trrust_config.filtering_functions),
        partial(add_regnetwork_edges, regnetwork_filtering_funcs=config.regnetwork_config.filtering_functions),
    ],
)
```

## Installation
The dev environment includes GPU Builds (CUDA 11.1) for each of the deep learning libraries integrated into graphein.
```bash
git clone https://www.github.com/a-r-j/graphein
cd graphein
conda create env -f environment-dev.yml
pip install -e .
```

A lighter install can be performed with:

```bash
git clone https://www.github.com/a-r-j/graphein
cd graphein
conda create env -f environment.yml
pip install -e .
```

## Citing Graphein

Please consider citing graphein if it proves useful in your work.

```
@article{Jamasb2020,
  doi = {10.1101/2020.07.15.204701},
  url = {https://doi.org/10.1101/2020.07.15.204701},
  year = {2020},
  month = jul,
  publisher = {Cold Spring Harbor Laboratory},
  author = {Arian Rokkum Jamasb and Pietro Lio and Tom Blundell},
  title = {Graphein - a Python Library for Geometric Deep Learning and Network Analysis on Protein Structures}
}
```

