Metadata-Version: 2.1
Name: taxoniq
Version: 0.1.5
Summary: Taxoniq: Taxon Information Query - fast, offline querying of NCBI Taxonomy and related data
Home-page: https://github.com/chanzuckerberg/taxoniq
Author: Andrey Kislyuk
Author-email: akislyuk@chanzuckerberg.com
License: MIT License
Project-URL: Documentation, https://chanzuckerberg.github.io/taxoniq
Project-URL: Source Code, https://github.com/chanzuckerberg/taxoniq
Project-URL: Issue Tracker, https://github.com/chanzuckerberg/taxoniq/issues
Description: Taxoniq: Taxon Information Query - fast, offline querying of NCBI Taxonomy and related data
        ===========================================================================================
        
        Taxoniq is a Python and command-line interface to the
        [NCBI Taxonomy database](https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7408187/) and selected data sources that
        cross-reference it.
        
        Taxoniq's features include:
        
        - Pre-computed indexes updated monthly from NCBI, [WoL](https://biocore.github.io/wol/) and cross-referenced databases
        - Offline operation: all indexes are bundled with the package; no network calls are made when querying taxon information
          (separately, Taxoniq can fetch the nucleotide or protein sequences over the network given a taxon or accession - see
          **Retrieving sequences** below)
        - A CLI capable of JSON I/O, batch processing and streaming of inputs for ease of use and pipelining in shell scripts
        - A stable, well-documented, type-hinted Python API (Python 3.6 and higher is supported)
        - Comprehensive testing and continuous integration
        - An intuitive interface with useful defaults
        - Compactness, readability, and extensibility
        
        The Taxoniq package bundles an indexed, compressed copy of the
        [NCBI taxonomy database files](https://ncbiinsights.ncbi.nlm.nih.gov/2018/02/22/new-taxonomy-files-available-with-lineage-type-and-host-information/),
        the [NCBI RefSeq](https://www.ncbi.nlm.nih.gov/refseq/) nucleotide and protein accessions associated with each taxon,
        the [WoL](https://biocore.github.io/wol/) kingdom-wide phylogenomic distance database, and relevant information from
        other databases. Accessions which appear in the NCBI RefSeq BLAST databases are indexed so that
        given a taxon ID, accession ID, or taxon name, you can quickly retrieve the taxon's rank, lineage, description,
        citations, representative RefSeq IDs, LCA information, evolutionary distance, sequence (with a network call), and more,
        as described in the **Cookbook** section below.
        
        ## Installation
        
            pip3 install taxoniq
        
        ## Synopsis
        
        ```python
        >>> import taxoniq
        >>> t = taxoniq.Taxon(9606)
        >>> t.scientific_name
        'Homo sapiens'
        >>> t.common_name
        'human'
        
        >>> t.ranked_lineage
        [taxoniq.Taxon(9606), taxoniq.Taxon(9605), taxoniq.Taxon(9604), taxoniq.Taxon(9443),
         taxoniq.Taxon(40674), taxoniq.Taxon(7711), taxoniq.Taxon(33208), taxoniq.Taxon(2759)]
        >>> len(t.lineage)
        32
        >>> [(t.rank.name, t.scientific_name) for t in t.ranked_lineage]
        [('species', 'Homo sapiens'), ('genus', 'Homo'), ('family', 'Hominidae'), ('order', 'Primates'),
         ('class', 'Mammalia'), ('phylum', 'Chordata'), ('kingdom', 'Metazoa'), ('superkingdom', 'Eukaryota')]
        >>> [(c.rank.name, c.common_name) for c in t.child_nodes]
        [('subspecies', 'Neandertal'), ('subspecies', 'Denisova hominin')]
        
        >>> t.refseq_representative_genome_accessions[:10]
        [taxoniq.Accession('NC_000001.11'), taxoniq.Accession('NC_000002.12'), taxoniq.Accession('NC_000003.12'),
         taxoniq.Accession('NC_000004.12'), taxoniq.Accession('NC_000005.10'), taxoniq.Accession('NC_000006.12'),
         taxoniq.Accession('NC_000007.14'), taxoniq.Accession('NC_000008.11'), taxoniq.Accession('NC_000009.12'),
         taxoniq.Accession('NC_000010.11')]
        
        >>> t.url
        'https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=9606'
        
        # Wikidata provides structured links to many databases about taxa represented on Wikipedia
        >>> t.wikidata_url
        'https://www.wikidata.org/wiki/Q15978631'
        ```
        
        ```
        >>> t2 = taxoniq.Taxon(scientific_name="Bacillus anthracis")
        >>> t2.description
        '<p class="mw-empty-elt"> </p> <p class="mw-empty-elt"> </p> <p><i><b>Bacillus anthracis</b></i>
         is the agent of anthrax—a common disease of livestock and, occasionally, of humans—and the only
         obligate pathogen within the genus <i>Bacillus</i>. This disease can be classified as a zoonosis,
         causing infected animals to transmit the disease to humans. <i>B. anthracis</i> is a Gram-positive,
         endospore-forming, rod-shaped bacterium, with a width of 1.0–1.2 µm and a length of 3–5&#160;µm.
         It can be grown in an ordinary nutrient medium under aerobic or anaerobic conditions.</p>
         <p>It is one of few bacteria known to synthesize a protein capsule (poly-D-gamma-glutamic acid).
         Like <i>Bordetella pertussis</i>, it forms a calmodulin-dependent adenylate cyclase exotoxin known
         as anthrax edema factor, along with anthrax lethal factor. It bears close genotypic and phenotypic
         resemblance to <i>Bacillus cereus</i> and <i>Bacillus thuringiensis</i>. All three species share
         cellular dimensions and morphology</p>...'
        ```
        
        ```python
        >>> t3 = taxoniq.Taxon(accession_id="NC_000913.3")
        >>> t3.scientific_name
        'Escherichia coli str. K-12 substr. MG1655"'
        >>> t3.parent.parent.common_name
        'E. coli'
        >>> t3.refseq_representative_genome_accessions[0].length
        4641652
        
        # The get_from_s3() method is the only command that will trigger a network call.
        >>> seq = t3.refseq_representative_genome_accessions[0].get_from_s3().read()
        >>> len(seq)
        4641652
        >>> seq[:64]
        b'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGAT'
        ```
        
        ## Retrieving sequences
        
        Mirrors of the NCBI BLAST databases are maintained on [AWS S3](https://registry.opendata.aws/ncbi-blast-databases/)
        (`s3://ncbi-blast-databases`) and Google Storage (`gs://blast-db`). This is a key resource, since S3 and GS have
        superior bandwidth and throughput compared to the NCBI FTP server, so range requests can be used to retrieve individual
        sequences from the database files without downloading and keeping a copy of the whole database.
        
        The Taxoniq PyPI distribution (the package you install using `pip3 install taxoniq`) indexes accessions for the
        following NCBI BLAST databases:
        
        - Refseq viruses representative genomes (`ref_viruses_rep_genomes`) (nucleotide)
        - Refseq prokaryote representative genomes (contains refseq assembly) (`ref_prok_rep_genomes`) (nucleotide)
        - RefSeq Eukaryotic Representative Genome Database (`ref_euk_rep_genomes`) (nucleotide)
        - Betacoronavirus (nucleotide)
        
        Given an accession ID, Taxoniq can issue a single HTTP request and return a file-like object streaming the nucleotide
        sequence for this accession from the S3 or GS mirror as follows:
        ```python
        with taxoniq.Accession("NC_000913.3").get_from_s3() as fh:
             fh.read()
        ```
        
        To retrieve many sequences quickly, you may want to use a threadpool to open multiple network connections at once:
        ```python
        from concurrent.futures import ThreadPoolExecutor
        def fetch_seq(accession):
            seq = accession.get_from_s3().read()
            return (accession, seq)
        
        taxon = taxoniq.Taxon(scientific_name="Apis mellifera")
        for accession, seq in ThreadPoolExecutor().map(fetch_seq, taxon.refseq_representative_genome_accessions):
            print(accession, len(seq))
        ```
        
        ## Command-line interface
        `pip3 install taxoniq` installs a command-line utility, `taxoniq`, which can be used to perform many of the same
        functions provided by the Python API:
        ```
        >taxoniq child_nodes --taxon-id 2 --output-format '{tax_id}: {scientific_name}'
        [
            "1224: Proteobacteria",
            "2323: Bacteria incertae sedis",
            "32066: Fusobacteria",
            "40117: Nitrospirae",
            "48479: environmental samples",
            "49928: unclassified Bacteria",
            "57723: Acidobacteria",
            "68297: Dictyoglomi",
            "74152: Elusimicrobia",
            "200783: Aquificae",
            "200918: Thermotogae",
            "200930: Deferribacteres",
            "200938: Chrysiogenetes",
            "200940: Thermodesulfobacteria",
            "203691: Spirochaetes",
            "508458: Synergistetes",
            "1783257: PVC group",
            "1783270: FCB group",
            "1783272: Terrabacteria group",
            "1802340: Nitrospinae/Tectomicrobia group",
            "1930617: Calditrichaeota",
            "2138240: Coprothermobacterota",
            "2498710: Caldiserica/Cryosericota group",
            "2698788: Candidatus Krumholzibacteriota",
            "2716431: Coleospermum",
            "2780997: Vogosella"
        ]
        ```
        See `taxoniq --help` for full details.
        
        ## Using the nr/nt databases
        Because of their size, taxoniq wheels with indexes of the NT (GenBank Non-redundant nucleotide) BLAST database are
        distributed on GitHub instead of PyPI. After running `pip3 install taxoniq`, you can install the NT indexes as follows:
        
        - Navigate to https://github.com/chanzuckerberg/taxoniq/releases/latest
        - For each "Python Wheel with NT index" asset:
          - Right-click on the asset link, and click "Copy link address"
          - Run `pip3 install --upgrade <PASTED LINK ADDRESS>`
        
        The NT index packages also contain indexes for the Refseq representative genomes and Betacoronavirus accessions (meaning
        they are are superset of the PyPI packages).
        
        ## Cookbook
        In progress
        
        ## Links
        * [Project home page (GitHub)](https://github.com/chanzuckerberg/taxoniq)
        * [Documentation](https://chanzuckerberg.github.io/taxoniq/)
        * [Package distribution (PyPI)](https://pypi.python.org/pypi/taxoniq)
        * [Change log](https://github.com/chanzuckerberg/taxoniq/blob/master/Changes.md)
        
        ## License
        Taxoniq software is licensed under the terms of the [MIT License](LICENSE).
        
        Distributions of this package contain data from the
        [National Center for Biotechnology Information](https://www.ncbi.nlm.nih.gov/) released into the public domain under the
        [NCBI Public Domain Notice](LICENSE.NCBI).
        
        Distributions of this package contain text excerpts from Wikipedia licensed under the terms of the
        [CC-BY-SA License](LICENSE.WIKIPEDIA).
        
        ## Bugs
        Please report bugs, issues, feature requests, etc. on [GitHub](https://github.com/chanzuckerberg/taxoniq/issues).
        
Platform: MacOS X
Platform: Posix
Classifier: Intended Audience :: Developers
Classifier: License :: OSI Approved :: MIT License
Classifier: Operating System :: MacOS :: MacOS X
Classifier: Operating System :: POSIX
Classifier: Programming Language :: Python
Classifier: Programming Language :: Python :: 3.6
Classifier: Programming Language :: Python :: 3.7
Classifier: Programming Language :: Python :: 3.8
Classifier: Programming Language :: Python :: 3.9
Classifier: Topic :: Software Development :: Libraries :: Python Modules
Description-Content-Type: text/markdown
