Metadata-Version: 1.1
Name: pyfastx
Version: 0.2.0
Summary: pyfastx is a python module for fast randomaccess to FASTA sequences from flat text fileor even from gzip compressed file.
Home-page: https://github.com/lmdu/pyfastx
Author: Lianming Du
Author-email: adullb@qq.com
License: MIT
Description: pyfastx
        =======
        
        .. image:: https://travis-ci.org/lmdu/pyfastx.svg?branch=master
            :target: https://travis-ci.org/lmdu/pyfastx
        .. image:: https://ci.appveyor.com/api/projects/status/7qeurb8wcl0bw993?svg=true
            :target: https://ci.appveyor.com/project/lmdu/pyfastx
        .. image:: https://readthedocs.org/projects/pyfastx/badge/?version=latest
            :target: https://pyfastx.readthedocs.io/en/latest/?badge=latest
        .. image:: https://img.shields.io/pypi/v/pyfastx.svg
        .. image:: https://img.shields.io/pypi/pyversions/pyfastx.svg
        .. image:: https://img.shields.io/pypi/wheel/pyfastx.svg
        
        
        *a robust python module for fast random access to FASTA sequences*
        
        About
        -----
        
        The pyfastx is a lightweight Python C extension that enables you to randomly access FASTA sequences in flat text file, even in gzip compressed file. This module uses `kseq.h <http://lh3lh3.users.sourceforge.net/kseq.shtml>`_ written by Heng Li to parse FASTA file and zran.c written by Paul McCarthy in `indexed_gzip <https://github.com/pauldmccarthy/indexed_gzip>`_ project to index gzipped file.
        
        Installation
        ------------
        
        Make sure you have both `pip <https://pip.pypa.io/en/stable/installing/>`_ and at least version 3.5 of Python before starting.
        
        You can install ``pyfastx`` via the Python Package Index (PyPI)
        
        ::
        
            pip install pyfastx
        
        Read FASTA file
        ---------------
        
        The fastest way to parse flat or gzipped FASTA file without building index.
        
        .. code:: python
        
            >>> import pyfastx
            >>> for name, seq in pyfastx.Fasta('test/data/test.fa.gz', build_index=False):
            >>>     print(name, seq)
        
        Read flat or gzipped FASTA file and build index, support for random access to FASTA.
        
        .. code:: python
        
            >>> import pyfastx
            >>> fa = pyfastx.Fasta('test/data/test.fa.gz')
            >>> fa
            <Fasta> test/data/test.fa.gz contains 211 seqs
        
        Note: Building index may take some times. The time required to build index depends on the size of FASTA file. If index built, you can randomly access to any sequences in FASTA file.
        
        Get FASTA information
        ---------------------
        
        .. code:: python
        
            >>> # get sequence counts in FASTA
            >>> len(fa)
            211
        
            >>> # get total sequnce length of FASTA
            >>> fa.size
            86262
        
            >>> # get GC content of DNA sequence of FASTA
            >>> fa.gc_content
            43.529014587402344
        
            >>> # get composition of nucleotides in FASTA
            >>> fa.composition
            {'A': 24534, 'C': 18694, 'G': 18855, 'T': 24179, 'N': 0}
        
        Get sequence from FASTA
        -----------------------
        
        .. code:: python
        
            >>> # get sequence like dictionary
            >>> s1 = fa['JZ822577.1']
            >>> s1
            <Sequence> JZ822577.1 with length of 333
        
            >>> # get sequence like list
            >>> s2 = fa[2]
            >>> s2
            <Sequence> JZ822579.1 with length of 176
        
            >>> # get last sequence
            >>> s3 = fa[-1]
            >>> s3
            <Sequence> JZ840318.1 with length of 134
        
            >>> # check name weather in FASTA file
            >>> 'JZ822577.1' in fa
            True
        
        Get sequence information
        ------------------------
        
        .. code:: python
        
            >>> s = fa[-1]
            >>> s
            <Sequence> JZ840318.1 with length of 134
        
            >>> # get sequence name
            >>> s.name
            'JZ840318.1'
        
            >>> # get sequence string
            >>> s.seq
            'ACTGGAGGTTCTTCTTCCTGTGGAAAGTAACTTGTTTTGCCTTCACCTGCCTGTTCTTCACATCAACCTTGTTCCCACACAAAACAATGGGAATGTTCTCACACACCCTGCAGAGATCACGATGCCATGTTGGT'
        
            >>> # get sequence length
            >>> len(s)
            134
        
            >>> # get GC content if dna sequence
            >>> s.gc_content
            46.26865768432617
        
            >>> # get nucleotide composition if dna sequence
            >>> s.composition
            {'A': 31, 'C': 37, 'G': 25, 'T': 41, 'N': 0}
        
        Sequence slice
        --------------
        
        Sequence object can be sliced like a python string
        
        .. code:: python
        
            >>> # get a sub seq from sequence
            >>> ss = seq[10:30]
            >>> ss
            <Sequence> JZ840318.1 from 11 to 30
        
            >>> ss.name
            'JZ840318.1:11-30'
        
            >>> ss.seq
            'CTTCTTCCTGTGGAAAGTAA'
        
            >>> ss = s[-10:]
            >>> ss
            <Sequence> JZ840318.1 from 125 to 134
        
            >>> ss.name
            'JZ840318.1:125-134'
        
            >>> ss.seq
            'CCATGTTGGT'
        
        
        Note: Slicing start and end coordinates are 0-based. Currently, pyfastx does not support an optional third ``step`` or ``stride`` argument. For example ``ss[::-1]``
        
        Reverse and complement sequence
        -------------------------------
        
        .. code:: python
        
            >>> # get sliced sequence
            >>> fa[0][10:20].seq
            'GTCAATTTCC'
        
            >>> # get reverse of sliced sequence
            >>> fa[0][10:20].reverse
            'CCTTTAACTG'
        
            >>> # get complement of sliced sequence
            >>> fa[0][10:20].complement
            'CAGTTAAAGG'
        
            >>> # get reversed complement sequence, corresponding to sequence in antisense strand
            >>> fa[0][10:20].antisense
            'GGAAATTGAC'
        
        Get subsequences
        ----------------
        
        Subseuqneces can be retrieved from FASTA file by using a list of [start, end] coordinates
        
        .. code:: python
        
            >>> # get subsequence with start and end position
            >>> interval = (1, 10)
            >>> fa.get_seq('JZ822577.1', interval)
            'CTCTAGAGAT'
        
            >>> # get subsequences with a list of start and end position
            >>> intervals = [(1, 10), (50, 60)]
            >>> fa.get_seq('JZ822577.1', intervals)
            'CTCTAGAGATTTTAGTTTGAC'
        
            >>> # get subsequences with reverse strand
            >>> fa.get_seq('JZ822577.1', (1, 10), strand='-')
            'ATCTCTAGAG'
        
        Get identifiers
        ---------------
        
        Get all identifiers of sequence as a list-like object.
        
        .. code:: python
        
            >>> ids = fa.keys()
            >>> ids
            <Identifier> contains 211 identifiers
        
            >>> # get count of sequence
            >>> len(ids)
            211
        
            >>> # get identifier by index
            >>> ids[0]
            'JZ822577.1'
        
            >>> # check identifier where in fasta
            >>> 'JZ822577.1' in ids
            True
        
            >>> # iter identifiers
            >>> for name in ids:
            >>>     print(name)
        
            >>> # convert to a list
            >>> list(ids)
        
Keywords: fasta sequence bioinformatics
Platform: UNKNOWN
Classifier: Development Status :: 3 - Alpha
Classifier: Intended Audience :: Developers
Classifier: Intended Audience :: Education
Classifier: Intended Audience :: Science/Research
Classifier: Natural Language :: English
Classifier: License :: OSI Approved :: MIT License
Classifier: Programming Language :: C
Classifier: Programming Language :: Python :: 3.5
Classifier: Programming Language :: Python :: 3.6
Classifier: Programming Language :: Python :: 3.7
Classifier: Operating System :: Microsoft :: Windows
Classifier: Operating System :: POSIX :: Linux
Classifier: Operating System :: Unix
Classifier: Topic :: Scientific/Engineering :: Bio-Informatics
