gene	sg_id	change	functional_effect	functional_effect	sequence_ontology	rs_id	wt_allele	var_allele	hg19_pos	hg19_allele	hg19_revertant	hg38_pos	hg38_allele	hg38_revertant	variant_impact	type	causal	cadd	lof	overlap	note
abcb1	sg1	3435C>T	I1145#	I1145#	synonymous_variant	rs1045642	G	A	87138645	A	revertant	87509329	A	revertant	low_impact	snv	.	0.801	no	.	.
abcb1	sg2	2677G>T	S893A	S893A	missense_variant	rs2032582	C	A	87160618	A	revertant	87531302	A	revertant	moderate_impact	snv	.	17.16	no	.	.
abcb1	sg3	1236C>T	G412#	G412#	synonymous_variant	rs1128503	G	A	87179601	A	revertant	87550285	A	revertant	low_impact	snv	.	6.487	no	.	.
cacna1s	sg1	.	frameshift	frameshift	frameshift_variant	.	CT	C	201012424	CT	not_revertant	201043296	CT	not_revertant	high_impact	indel	unknown_function	35	yes	.	.
cacna1s	sg2	.	no_effect	no_effect	intron_variant	rs4915473	T	C	201026916	T	not_revertant	201057788	T	not_revertant	low_impact	snv	.	1.844	no	.	.
cacna1s	sg3	.	no_effect	no_effect	intron_variant	rs11306691	AT	A	201026940	AT	not_revertant	201057812	AT	not_revertant	low_impact	indel	.	1.241	no	.	.
cacna1s	sg4	.	no_effect	no_effect	intron_variant	rs4915474	C	T	201027055	C	not_revertant	201057927	C	not_revertant	low_impact	snv	.	6.097	no	.	.
cacna1s	sg5	.	no_effect	no_effect	intron_variant	rs4915475	T	C	201029431	T	not_revertant	201060303	T	not_revertant	low_impact	snv	.	1.819	no	.	.
cacna1s	sg6	.	Q1138R	Q1138R	missense_variant	rs184128317	T	C	201029787	T	not_revertant	201060659	T	not_revertant	high_impact	snv	unknown_function	34	no	.	.
cacna1s	sg7	.	Y1101H	Y1101H	missense_variant	.	A	G	201029899	A	not_revertant	201060771	A	not_revertant	moderate_impact	snv	.	27.1	no	.	.
cacna1s	sg8	3257G>A	R1086H	R1086H	missense_variant	rs1800559	C	T	201029943	C	not_revertant	201060815	C	not_revertant	moderate_impact	snv	unknown_function	24.3	no	.	.
cacna1s	sg9	.	no_effect	no_effect	intron_variant	rs2297903	A	C	201031307	A	not_revertant	201062179	A	not_revertant	low_impact	snv	.	6.737	no	.	.
cacna1s	sg10	.	S606G	S606G	missense_variant	.	T	C	201046059	T	not_revertant	201076931	T	not_revertant	moderate_impact	snv	.	26.3	no	.	.
cacna1s	sg11	520C>T	R174W	R174W	missense_variant	rs772226819	G	A	201061121	G	not_revertant	201091993	G	not_revertant	moderate_impact	snv	unknown_function	29.6	no	.	.
cftr	sg1	NG_016465.3:g.48252G>A	E56K	E56K	missense_variant	rs397508256	G	A	117149089	G	not_revertant	117509035	G	not_revertant	high_impact	snv	unknown_function	34	no	.	.
cftr	sg2	NG_016465.3:g.48286C>T	P67L	P67L	missense_variant	rs368505753	C	T	117149123	C	not_revertant	117509069	C	not_revertant	high_impact	snv	Class_IV	27.4	no	.	.
cftr	sg3	NG_016465.3:g.48306C>T	R74W	R74W	missense_variant	rs115545701	C	T	117149143	C	not_revertant	117509089	C	not_revertant	moderate_impact	snv	unknown_function	24.6	no	.	.
cftr	sg4	NG_016465.3:g.48340G>A	G85E	G85E	missense_variant	rs75961395	G	A	117149177	G	not_revertant	117509123	G	not_revertant	high_impact	snv	Class_II	27.9	no	.	.
cftr	sg5	.	no_effect	no_effect	intron_variant	.	T	C	117149761	T	not_revertant	117509707	C	revertant	low_impact	snv	.	0.157	no	.	.
cftr	sg6	NG_016465.3:g.70170G>C	D110H	D110H	missense_variant	rs113993958	G	C	117171007	G	not_revertant	117530953	G	not_revertant	moderate_impact	snv	unknown_function	26.1	no	.	.
cftr	sg7	NG_016465.3:g.70172C>T	D110E	D110E	missense_variant	rs397508537	C	A	117171009	C	not_revertant	117530955	C	not_revertant	moderate_impact	snv	unknown_function	22.1	no	.	.
cftr	sg8	NG_016465.3:g.70191C>T	R117C	R117C	missense_variant	rs77834169	C	T	117171028	C	not_revertant	117530974	C	not_revertant	high_impact	snv	Class_IV	26.1	no	.	.
cftr	sg9	NG_016465.3:g.70192G>A	R117H	R117H	missense_variant	rs78655421	G	A	117171029	G	not_revertant	117530975	G	not_revertant	high_impact	snv	Class_IV	26.8	no	.	.
cftr	sg10	NG_016465.3:g.70192G>T	R117L	R117L	missense_variant	rs78655421	G	T	117171029	G	not_revertant	117530975	G	not_revertant	moderate_impact	snv	.	24.6	no	.	.
cftr	sg11	NG_016465.3:g.73535G>A	G178R	G178R	missense_variant	rs80282562	G	A	117174372	G	not_revertant	117534318	G	not_revertant	high_impact	snv	unknown_function	30	no	.	.
cftr	sg12	NG_016465.3:g.73580G>A	E193K	E193K	missense_variant	rs397508759	G	A	117174417	G	not_revertant	117534363	G	not_revertant	high_impact	snv	unknown_function	34	no	.	.
cftr	sg13	NG_016465.3:g.73583G>T	splicing_defect	splicing_defect	splice_donor_variant	rs77188391	G	T	117174420	G	not_revertant	117534366	G	not_revertant	high_impact	snv	Class_I	34	yes	.	.
cftr	sg14	NG_016465.3:g.74502T>G	L206W	L206W	missense_variant	rs121908752	T	G	117175339	T	not_revertant	117535285	T	not_revertant	moderate_impact	snv	unknown_function	24.8	no	.	.
cftr	sg15	NG_016465.3:g.79487G>A	R347H	R347H	missense_variant	rs77932196	G	A	117180324	G	not_revertant	117540270	G	not_revertant	high_impact	snv	Class_IV	32	no	.	.
cftr	sg16	.	R352W	R352W	missense_variant	rs193922497	C	T	117180338	C	not_revertant	117540284	C	not_revertant	high_impact	snv	unknown_function	32	no	.	.
cftr	sg17	NG_016465.3:g.79502G>A	R352Q	R352Q	missense_variant	rs121908753	G	A	117180339	G	not_revertant	117540285	G	not_revertant	high_impact	snv	unknown_function	32	no	.	.
cftr	sg18	.	no_effect	no_effect	intron_variant	rs2237725	A	G	117181152	A	not_revertant	117541098	A	not_revertant	low_impact	snv	.	2.221	no	.	.
cftr	sg19	.	no_effect	no_effect	intron_variant	rs4148703	G	A	117181509	G	not_revertant	117541455	G	not_revertant	low_impact	snv	.	3.055	no	.	.
cftr	sg20	.	no_effect	no_effect	intron_variant	rs4148704	AT	A	117181704	AT	not_revertant	117541650	AT	not_revertant	low_impact	indel	.	0.662	no	.	.
cftr	sg21	.	A399V	A399V	missense_variant	rs146463120	C	T	117182149	C	not_revertant	117542095	C	not_revertant	moderate_impact	snv	.	25.9	no	.	.
cftr	sg22	.	L453del	L453del	inframe_deletion	rs397508194	AGTT	A	117188840	AGTT	not_revertant	117548786	AGTT	not_revertant	moderate_impact	indel	.	19.96	no	.	.
cftr	sg23	NG_016465.3:g.88012C>A	A455E	A455E	missense_variant	rs74551128	C	A	117188849	C	not_revertant	117548795	C	not_revertant	high_impact	snv	Class_V	26.6	no	.	.
cftr	sg24	.	K464N	K464N	missense_variant	rs397508198	G	T	117188877	G	not_revertant	117548823	G	not_revertant	high_impact	snv	.	33	no	.	.
cftr	sg25	NG_016465.3:g.98809_98811delCTT	F508del	F508del	missense_variant	rs113993960	TCTT	T	117199645	TCTT	not_revertant	117559591	TCTT	not_revertant	high_impact	indel	Class_II_&_IV	21.3	no	.	.
cftr	sg26	.	no_effect	no_effect	intron_variant	rs2106152	T	C	117223442	T	not_revertant	117583388	T	not_revertant	low_impact	snv	.	0.509	no	.	.
cftr	sg27	.	no_effect	no_effect	intron_variant	rs2106153	G	C	117223444	G	not_revertant	117583390	G	not_revertant	low_impact	snv	.	1.231	no	.	.
cftr	sg28	.	no_effect	no_effect	intron_variant	rs213960	G	A	117224440	G	not_revertant	117584386	G	not_revertant	low_impact	snv	.	1.802	no	.	.
cftr	sg29	NG_016465.3:g.127016A>C	S549R	S549R	missense_variant	rs121908757	A	C	117227853	A	not_revertant	117587799	A	not_revertant	high_impact	snv	Class_II	27.4	no	.	.
cftr	sg30	NG_016465.3:g.127017G>A	S549N	S549N	missense_variant	rs121908755	G	A	117227854	G	not_revertant	117587800	G	not_revertant	high_impact	snv	Class_II	27.1	no	.	.
cftr	sg31	NG_016465.3:g.127018T>G	S549R	S549R	missense_variant	rs121909005	T	G	117227855	T	not_revertant	117587801	T	not_revertant	high_impact	snv	Class_II	24.7	no	.	.
cftr	sg32	NG_016465.3:g.127022G>A	G551S	G551S	missense_variant	rs121909013	G	A	117227859	G	not_revertant	117587805	G	not_revertant	high_impact	snv	Class_III	29.1	no	.	.
cftr	sg33	NG_016465.3:g.127023G>A	G551D	G551D	missense_variant	rs75527207	G	A	117227860	G	not_revertant	117587806	G	not_revertant	high_impact	snv	Class_III	28.5	no	.	.
cftr	sg34	NG_016465.3:g.129626A>G	D579G	D579G	missense_variant	rs397508288	A	G	117230463	A	not_revertant	117590409	A	not_revertant	moderate_impact	snv	unknown_function	27.2	no	.	.
cftr	sg35	NG_016465.3:g.134147G>T	E831X	E831X	stop_gained	rs397508387	G	T	117234984	G	not_revertant	117594930	G	not_revertant	high_impact	snv	unknown_function	45	yes	.	.
cftr	sg36	NG_016465.3:g.142085G>A	no_effect	no_effect	intron_variant	rs80224560	G	A	117242922	G	not_revertant	117602868	G	not_revertant	high_impact	snv	Class_V	22.6	no	.	.
cftr	sg37	NG_016465.3:g.142925C>T	S945L	S945L	missense_variant	rs397508442	C	T	117243762	C	not_revertant	117603708	C	not_revertant	high_impact	snv	unknown_function	33	no	.	.
cftr	sg38	NG_016465.3:g.145912C>T	S977F	S977F	missense_variant	rs141033578	C	T	117246749	C	not_revertant	117606695	C	not_revertant	moderate_impact	snv	unknown_function	29	no	.	.
cftr	sg39	NG_016465.3:g.4609A>G	no_effect	no_effect	intron_variant	rs76151804	A	G	117251609	A	not_revertant	117611555	A	not_revertant	high_impact	snv	Class_V	6.531	no	.	.
cftr	sg40	NG_016465.3:g.150812T>G	F1052V	F1052V	missense_variant	rs150212784	T	G	117251649	T	not_revertant	117611595	T	not_revertant	high_impact	snv	unknown_function	32	no	.	.
cftr	sg41	NG_016465.3:g.150837A>C	K1060T	K1060T	missense_variant	rs397508513	A	C	117251674	A	not_revertant	117611620	A	not_revertant	moderate_impact	snv	unknown_function	25.1	no	.	.
cftr	sg42	NG_016465.3:g.150857G>A	A1067T	A1067T	missense_variant	rs121909020	G	A	117251694	G	not_revertant	117611640	G	not_revertant	high_impact	snv	unknown_function	32	no	.	.
cftr	sg43	NG_016465.3:g.150863G>A	G1069R	G1069R	missense_variant	rs200321110	G	A	117251700	G	not_revertant	117611646	G	not_revertant	moderate_impact	snv	unknown_function	22.9	no	.	.
cftr	sg44	NG_016465.3:g.150866C>T	R1070W	R1070W	missense_variant	rs202179988	C	T	117251703	C	not_revertant	117611649	C	not_revertant	high_impact	snv	unknown_function	34	no	.	.
cftr	sg45	NG_016465.3:g.150867G>A	R1070Q	R1070Q	missense_variant	rs78769542	G	A	117251704	G	not_revertant	117611650	G	not_revertant	moderate_impact	snv	unknown_function	27.7	no	.	.
cftr	sg46	NG_016465.3:g.150880T>A	F1074L	F1074L	missense_variant	rs186045772	T	A	117251717	T	not_revertant	117611663	T	not_revertant	moderate_impact	snv	unknown_function	26.2	no	.	.
cftr	sg47	NG_016465.3:g.153916G>C	D1152H	D1152H	missense_variant	rs75541969	G	C	117254753	G	not_revertant	117614699	G	not_revertant	high_impact	snv	Class_IV	29.1	no	.	.
cftr	sg48	.	L1156P	L1156P	missense_variant	rs139729994	G	T	117254767	G	not_revertant	117614713	G	not_revertant	moderate_impact	snv	.	29.4	no	.	.
cftr	sg49	.	frameshift	frameshift	frameshift_variant	.	CT	C	117267716	CT	not_revertant	117627662	CT	not_revertant	high_impact	indel	unknown_function	35	yes	.	.
cftr	sg50	NG_016465.3:g.179178C>T	no_effect	no_effect	intron_variant	rs75039782	C	T	117280015	C	not_revertant	117639961	C	not_revertant	high_impact	snv	Class_V	3.875	no	.	.
cftr	sg51	NG_016465.4:g.181668G>A	G1244E	G1244E	missense_variant	rs267606723	G	A	117282505	G	not_revertant	117642451	G	not_revertant	high_impact	snv	Class_III	29.8	no	.	.
cftr	sg52	NG_016465.3:g.181689G>A	S1251N	S1251N	missense_variant	rs74503330	G	A	117282526	G	not_revertant	117642472	G	not_revertant	high_impact	snv	Class_IV	27	no	.	.
cftr	sg53	NG_016465.3:g.181700T>C	S1255P	S1255P	missense_variant	rs121909041	T	C	117282537	T	not_revertant	117642483	T	not_revertant	high_impact	snv	Class_III	22.5	no	.	.
cftr	sg54	NG_016465.3:g.181745G>A	D1270N	D1270N	missense_variant	rs11971167	G	A	117282582	G	not_revertant	117642528	G	not_revertant	high_impact	snv	unknown_function	31	no	.	.
cftr	sg55	.	G1349S	G1349S	missense_variant	rs201686600	G	A	117304823	G	not_revertant	117664769	G	not_revertant	high_impact	snv	unknown_function	32	no	.	.
cftr	sg56	NG_016465.3:g.203987G>A	G1349D	G1349D	missense_variant	rs193922525	G	A	117304824	G	not_revertant	117664770	G	not_revertant	high_impact	snv	Class_III	31	no	.	.
cyp1a1	sg1	3798T>C	no_effect	no_effect	downstream_gene_variant	rs4646903	A	G	75011641	A	not_revertant	74719300	A	not_revertant	low_impact	snv	unknown_function	2.405	no	.	.
cyp1a1	sg2	3204T>C	no_effect	no_effect	3_prime_UTR_variant	rs1800031	A	G	75012235	A	not_revertant	74719894	A	not_revertant	low_impact	snv	unknown_function	5.001	no	.	.
cyp1a1	sg3	2545C>G	P492R	P492R	missense_variant	rs28399430	G	C	75012894	G	not_revertant	74720553	G	not_revertant	moderate_impact	snv	unknown_function	25.2	no	.	.
cyp1a1	sg4	2499C>T	R477W	R477W	missense_variant	rs56240201	G	A	75012940	G	not_revertant	74720599	G	not_revertant	moderate_impact	snv	unknown_function	23.2	no	.	.
cyp1a1	sg5	2460C>T	R464C	R464C	missense_variant	rs41279188	G	A	75012979	G	not_revertant	74720638	G	not_revertant	high_impact	snv	unknown_function	32	no	.	.
cyp1a1	sg6	2460C>A	R464S	R464S	missense_variant	rs41279188	G	T	75012979	G	not_revertant	74720638	G	not_revertant	moderate_impact	snv	unknown_function	26.4	no	.	.
cyp1a1	sg7	2454A>G	I462V	I462V	missense_variant	rs1048943	T	C	75012985	T	not_revertant	74720644	T	not_revertant	moderate_impact	snv	normal_function	18.33	no	.	.
cyp1a1	sg8	2452C>A	T461N	T461N	missense_variant	rs1799814	G	T	75012987	G	not_revertant	74720646	G	not_revertant	moderate_impact	snv	unknown_function	15.73	no	.	.
cyp1a1	sg9	2413T>A	I448N	I448N	missense_variant	rs72547509	A	T	75013026	A	not_revertant	74720685	A	not_revertant	moderate_impact	snv	unknown_function	23	no	.	.
cyp1a1	sg10	2345_2346insT	frameshift	frameshift	frameshift_variant	rs72547510	C	CA	75013093	C	not_revertant	74720752	C	not_revertant	high_impact	indel	unknown_function	23.8	yes	.	.
cyp1a1	sg11	.	R377X	R377X	stop_gained	rs768212140	G	A	75013577	G	not_revertant	74721236	G	not_revertant	high_impact	snv	unknown_function	37	yes	.	.
cyp1a1	sg12	1635G>T	M331I	M331I	missense_variant	rs56313657	C	A	75013804	C	not_revertant	74721463	C	not_revertant	moderate_impact	snv	unknown_function	18.98	no	.	.
cyp1a1	sg13	184G>C	A62P	A62P	missense_variant	rs143070677	C	G	75015255	C	not_revertant	74722914	C	not_revertant	moderate_impact	snv	unknown_function	23.4	no	.	.
cyp1a1	sg14	134G>A	G45D	G45D	missense_variant	rs4646422	C	T	75015305	C	not_revertant	74722964	C	not_revertant	moderate_impact	snv	unknown_function	23.5	no	.	.
cyp1a2	sg1	-3860G>A	no_effect	no_effect	upstream_gene_variant	rs2069514	G	A	75038220	G	not_revertant	74745879	G	not_revertant	high_impact	snv	decreased_function	2	no	.	.
cyp1a2	sg2	-2467delT	no_effect	no_effect	upstream_gene_variant	rs35694136	AT	A	75039612	AT	not_revertant	74747271	AT	not_revertant	low_impact	indel	.	0.489	no	.	.
cyp1a2	sg3	-739T>G	no_effect	no_effect	intron_variant	rs2069526	T	G	75041341	T	not_revertant	74749000	T	not_revertant	low_impact	snv	.	1.908	no	.	.
cyp1a2	sg4	-729C>T	no_effect	no_effect	intron_variant	rs12720461	C	T	75041351	C	not_revertant	74749010	C	not_revertant	low_impact	snv	.	1.775	no	.	.
cyp1a2	sg5	-163C>A	no_effect	no_effect	intron_variant	rs762551	C	A	75041917	C	not_revertant	74749576	C	not_revertant	high_impact	snv	increased_expression	0.066	no	.	.
cyp1a2	sg6	63C>G	F21L	F21L	missense_variant	rs56160784	C	G	75042142	C	not_revertant	74749801	C	not_revertant	moderate_impact	snv	unknown_function	23.4	no	.	.
cyp1a2	sg7	125C>G	P42R	P42R	missense_variant	rs72547511	C	G	75042204	C	not_revertant	74749863	C	not_revertant	high_impact	snv	decreased_function	24	no	.	.
cyp1a2	sg8	248C>T	T83M	T83M	missense_variant	rs138652540	C	T	75042327	C	not_revertant	74749986	C	not_revertant	moderate_impact	snv	unknown_function	18.08	no	.	.
cyp1a2	sg9	.	L98Q	L98Q	missense_variant	rs773366123	T	A	75042372	T	not_revertant	74750031	T	not_revertant	moderate_impact	snv	.	28.1	no	.	.
cyp1a2	sg10	502G>C	E168Q	E168Q	missense_variant	rs72547512	G	C	75042581	G	not_revertant	74750240	G	not_revertant	moderate_impact	snv	unknown_function	25	no	.	.
cyp1a2	sg11	558C>A	F186L	F186L	missense_variant	rs72547513	C	A	75042637	C	not_revertant	74750296	C	not_revertant	high_impact	snv	decreased_function	13.56	no	.	.
cyp1a2	sg12	634A>T	S212C	S212C	missense_variant	rs758748797	A	T	75042713	A	not_revertant	74750372	A	not_revertant	moderate_impact	snv	unknown_function	12.83	no	.	.
cyp1a2	sg13	1513C>A	S298R	S298R	missense_variant	rs17861157	C	A	75043592	C	not_revertant	74751251	C	not_revertant	moderate_impact	snv	.	0.039	no	.	.
cyp1a2	sg14	1514G>A	G299S	G299S	missense_variant	rs35796837	G	A	75043593	G	not_revertant	74751252	G	not_revertant	moderate_impact	snv	unknown_function	9.068	no	.	.
cyp1a2	sg15	2025A>C	no_effect	no_effect	splice_acceptor_variant	.	A	C	75044104	A	not_revertant	74751763	A	not_revertant	high_impact	snv	.	23.9	yes	.	.
cyp1a2	sg16	2116G>A	D348N	D348N	missense_variant	rs56276455	G	A	75044195	G	not_revertant	74751854	G	not_revertant	high_impact	snv	decreased_expression	24.6	no	.	.
cyp1a2	sg17	2159G>A	no_effect	no_effect	intron_variant	rs2472304	G	A	75044238	G	not_revertant	74751897	G	not_revertant	low_impact	snv	.	1.144	no	.	.
cyp1a2	sg18	2321G>C	no_effect	no_effect	intron_variant	rs3743484	G	C	75044400	G	not_revertant	74752059	G	not_revertant	low_impact	snv	.	0.211	no	.	.
cyp1a2	sg19	2473G>A	R377Q	R377Q	missense_variant	rs72547515	G	A	75044552	G	not_revertant	74752211	G	not_revertant	high_impact	snv	decreased_function	32	no	.	.
cyp1a2	sg20	2499A>T	I386F	I386F	missense_variant	rs72547516	A	T	75044578	A	not_revertant	74752237	A	not_revertant	high_impact	snv	decreased_expression	23.8	no	.	.
cyp1a2	sg21	3463C>T	T395M	T395M	missense_variant	rs149928755	C	T	75045542	C	not_revertant	74753201	C	not_revertant	moderate_impact	snv	.	15.93	no	.	.
cyp1a2	sg22	3468A>C	N397H	N397H	missense_variant	.	A	C	75045547	A	not_revertant	74753206	A	not_revertant	moderate_impact	snv	unknown_function	23.7	no	.	.
cyp1a2	sg23	3496G>A	C406Y	C406Y	missense_variant	rs55889066	G	A	75045575	G	not_revertant	74753234	G	not_revertant	moderate_impact	snv	unknown_function	15.78	no	.	.
cyp1a2	sg24	3533G>A	splicing_defect	splicing_defect	splice_donor_variant	rs56107638	G	A	75045612	G	not_revertant	74753271	G	not_revertant	high_impact	snv	decreased_function	28.1	yes	.	.
cyp1a2	sg25	.	no_effect	no_effect	intron_variant	rs12593808	G	T	75046677	G	not_revertant	74754336	G	not_revertant	low_impact	snv	.	5.11	no	.	.
cyp1a2	sg26	5090C>T	R431W	R431W	missense_variant	rs28399424	C	T	75047169	C	not_revertant	74754828	C	not_revertant	high_impact	snv	abolished_expression	24.3	no	.	.
cyp1a2	sg27	5105G>A	D436N	D436N	missense_variant	rs144148965	G	A	75047184	G	not_revertant	74754843	G	not_revertant	moderate_impact	snv	unknown_function	0.035	no	.	.
cyp1a2	sg28	5112C>T	T438I	T438I	missense_variant	rs45486893	C	T	75047191	C	not_revertant	74754850	C	not_revertant	moderate_impact	snv	unknown_function	13.91	no	.	.
cyp1a2	sg29	5166G>A	R456H	R456H	missense_variant	rs72547517	G	A	75047245	G	not_revertant	74754904	G	not_revertant	high_impact	snv	decreased_function	25.5	no	.	.
cyp1a2	sg30	5284C>A	Y495X	Y495X	stop_gained	rs143193369	C	A	75047363	C	not_revertant	74755022	C	not_revertant	high_impact	snv	unknown_function	35	yes	.	.
cyp1a2	sg31	5328G>A	R510Q	R510Q	missense_variant	rs374094758	G	A	75047407	G	not_revertant	74755066	G	not_revertant	moderate_impact	snv	unknown_function	12.78	no	.	.
cyp1a2	sg32	5347T>C	N516#	N516#	synonymous_variant	rs2470890	T	C	75047426	C	revertant	74755085	T	not_revertant	low_impact	snv	.	0.309	no	.	.
cyp1a2	sg33	.	no_effect	no_effect	3_prime_UTR_variant	rs11636419	A	G	75047600	A	not_revertant	74755259	A	not_revertant	low_impact	snv	.	2.246	no	.	.
cyp1a2	sg34	.	no_effect	no_effect	3_prime_UTR_variant	rs17861162	C	G	75048753	C	not_revertant	74756412	C	not_revertant	low_impact	snv	.	0.323	no	.	.
cyp1a2	sg35	.	no_effect	no_effect	downstream_gene_variant	rs7402578	T	C	75050507	T	not_revertant	74758166	T	not_revertant	low_impact	snv	.	0.378	no	.	.
cyp1a2	sg36	.	no_effect	no_effect	downstream_gene_variant	rs12591078	T	C	75050854	T	not_revertant	74758513	T	not_revertant	low_impact	snv	.	0.568	no	.	.
cyp1a2	sg37	.	no_effect	no_effect	downstream_gene_variant	rs11072501	A	G	75051008	A	not_revertant	74758667	A	not_revertant	low_impact	snv	.	0.155	no	.	.
cyp1a2	sg38	.	no_effect	no_effect	downstream_gene_variant	rs74025834	T	A	75051702	T	not_revertant	74759361	T	not_revertant	low_impact	snv	.	1.746	no	.	.
cyp1b1	sg1	.	no_effect	no_effect	3_prime_UTR_variant	rs10916	C	A	38297170	C	not_revertant	38070027	C	not_revertant	low_impact	snv	.	5.136	no	.	.
cyp1b1	sg2	.	no_effect	no_effect	3_prime_UTR_variant	rs162562	G	T	38297515	G	not_revertant	38070372	G	not_revertant	low_impact	snv	.	4.83	no	.	.
cyp1b1	sg3	.	no_effect	no_effect	3_prime_UTR_variant	rs4646431	C	CA	38297654	C	not_revertant	38070511	C	not_revertant	low_impact	indel	.	9.269	no	.	.
cyp1b1	sg4	4435_4461dup	frameshift	frameshift	frameshift_variant	rs72549373	AGAAAGTTCTTCGCCAATGCACCGCCT	AGAAAGTTCTTCGCCAATGCACCGCCTAGAAAGTTCTTCGCCAATGCACCGCCT	38298069	AGAAAGTTCTTCGCCAATGCACCGCCT	not_revertant	38070926	AGAAAGTTCTTCGCCAATGCACCGCCT	not_revertant	high_impact	indel	unknown_function	15.32	yes	.	.
cyp1b1	sg5	4437C>T	R469W	R469W	missense_variant	rs28936701	G	A	38298092	G	not_revertant	38070949	G	not_revertant	moderate_impact	snv	unknown_function	26.2	no	.	.
cyp1b1	sg6	.	frameshift	frameshift	frameshift_variant	rs777515179	G	GA	38298106	G	not_revertant	38070963	G	not_revertant	high_impact	indel	unknown_function	35	yes	.	.
cyp1b1	sg7	4390A>G	N453S	N453S	missense_variant	rs1800440	T	C	38298139	T	not_revertant	38070996	T	not_revertant	moderate_impact	snv	unknown_function	25	no	.	.
cyp1b1	sg8	.	D449#	D449#	synonymous_variant	rs1056837	A	G	38298150	A	not_revertant	38071007	A	not_revertant	low_impact	snv	.	0.904	no	.	.
cyp1b1	sg9	4360C>G	A443G	A443G	missense_variant	rs4986888	G	C	38298169	G	not_revertant	38071026	G	not_revertant	moderate_impact	snv	.	13.49	no	.	.
cyp1b1	sg10	4353G>C	D441H	D441H	missense_variant	rs4986887	C	G	38298176	C	not_revertant	38071033	C	not_revertant	moderate_impact	snv	.	24	no	.	.
cyp1b1	sg11	4342C>T	P437L	P437L	missense_variant	rs56175199	G	A	38298187	G	not_revertant	38071044	G	not_revertant	moderate_impact	snv	unknown_function	29.1	no	.	.
cyp1b1	sg12	4326C>G	L432V	L432V	missense_variant	rs1056836	G	C	38298203	C	revertant	38071060	G	not_revertant	moderate_impact	snv	unknown_function	16.2	no	.	.
cyp1b1	sg13	.	D430E	D430E	missense_variant	rs201181935	G	C	38298207	G	not_revertant	38071064	G	not_revertant	moderate_impact	snv	.	24	no	.	.
cyp1b1	sg14	4232_4241dup	frameshift	frameshift	frameshift_variant	rs587778873	TGGCATGAGG	TGGCATGAGGTGGCATGAGG	38298290	TGGCATGAGG	not_revertant	38071147	TGGCATGAGG	not_revertant	high_impact	indel	unknown_function	26.7	yes	.	.
cyp1b1	sg15	4201G>A	R390H	R390H	missense_variant	rs56010818	C	T	38298328	C	not_revertant	38071185	C	not_revertant	high_impact	snv	unknown_function	33	no	.	.
cyp1b1	sg16	4191G>A	E387K	E387K	missense_variant	rs55989760	C	T	38298338	C	not_revertant	38071195	C	not_revertant	high_impact	snv	unknown_function	33	no	.	.
cyp1b1	sg17	4168C>T	P379L	P379L	missense_variant	rs56305281	G	A	38298361	G	not_revertant	38071218	G	not_revertant	moderate_impact	snv	unknown_function	23.7	no	.	.
cyp1b1	sg18	4125G>T	G365W	G365W	missense_variant	rs55771538	C	A	38298404	C	not_revertant	38071261	C	not_revertant	high_impact	snv	unknown_function	33	no	.	.
cyp1b1	sg19	4125G>A	G365R	G365R	missense_variant	rs55771538	C	T	38298404	C	not_revertant	38071261	C	not_revertant	high_impact	snv	unknown_function	32	no	.	.
cyp1b1	sg20	4096_4108del	frameshift	frameshift	frameshift_variant	rs72549380	TTCTGCCTGCACTC	T	38298420	TTCTGCCTGCACTC	not_revertant	38071277	TTCTGCCTGCACTC	not_revertant	high_impact	indel	unknown_function	35	yes	.	.
cyp1b1	sg21	.	no_effect	no_effect	intron_variant	rs9341254	GA	G	38300041	GA	not_revertant	38072898	GA	not_revertant	low_impact	indel	.	5.999	no	.	.
cyp1b1	sg22	.	frameshift	frameshift	frameshift_variant	rs765666893	G	GAT	38301560	G	not_revertant	38074417	G	not_revertant	high_impact	indel	unknown_function	35	yes	.	.
cyp1b1	sg23	863_864insC	frameshift	frameshift	frameshift_variant	rs587778875	C	CG	38301663	C	not_revertant	38074520	C	not_revertant	high_impact	indel	unknown_function	23.3	yes	.	.
cyp1b1	sg24	841G>T	E281X	E281X	stop_gained	.	C	A	38301691	C	not_revertant	38074548	C	not_revertant	high_impact	snv	unknown_function	35	yes	.	.
cyp1b1	sg25	501_502insT	frameshift	frameshift	frameshift_variant	rs72549385	C	CA	38302030	C	not_revertant	38074887	C	not_revertant	high_impact	indel	unknown_function	26.6	yes	.	.
cyp1b1	sg26	355G>T	A119S	A119S	missense_variant	rs1056827	C	A	38302177	C	not_revertant	38075034	C	not_revertant	moderate_impact	snv	.	7.548	no	.	.
cyp1b1	sg27	182G>A	G61E	G61E	missense_variant	rs28936700	C	T	38302350	C	not_revertant	38075207	C	not_revertant	moderate_impact	snv	unknown_function	23.7	no	.	.
cyp1b1	sg28	171G>C	W57C	W57C	missense_variant	rs72549387	C	G	38302361	C	not_revertant	38075218	C	not_revertant	moderate_impact	snv	unknown_function	26.1	no	.	.
cyp1b1	sg29	142C>G	R48G	R48G	missense_variant	rs10012	G	C	38302390	G	not_revertant	38075247	G	not_revertant	moderate_impact	snv	.	5.129	no	.	.
cyp2a6	sg1	7160A>G	no_effect	no_effect	downstream_gene_variant	rs28742185	T	C	41349172	T	not_revertant	40843267	T	not_revertant	low_impact	snv	.	0.542	no	.	.
cyp2a6	sg2	6989A>G	no_effect	no_effect	downstream_gene_variant	rs72549453	T	C	41349343	T	not_revertant	40843438	T	not_revertant	low_impact	snv	.	0.946	no	.	.
cyp2a6	sg3	6961_6962insGAAAAG	no_effect	no_effect	downstream_gene_variant	rs72549452	G	GCTTTTC	41349371	G	not_revertant	40843466	G	not_revertant	low_impact	indel	.	2.494	no	.	.
cyp2a6	sg4	6936_6937insCACTT	no_effect	no_effect	downstream_gene_variant	rs72549451	T	TAAGTG	41349396	T	not_revertant	40843491	T	not_revertant	low_impact	indel	.	3.664	no	.	.
cyp2a6	sg5	6835C>A	no_effect	no_effect	3_prime_UTR_variant	rs28399483	G	T	41349497	G	not_revertant	40843592	G	not_revertant	low_impact	snv	.	0.112	no	.	.
cyp2a6	sg6	6782C>G	no_effect	no_effect	3_prime_UTR_variant	rs8192733	G	C	41349550	G	not_revertant	40843645	G	not_revertant	low_impact	snv	.	4.212	no	.	.
cyp2a6	sg7	6692C>G	no_effect	no_effect	3_prime_UTR_variant	rs7248240	G	C	41349640	G	not_revertant	40843735	G	not_revertant	low_impact	snv	.	1.127	no	.	.
cyp2a6	sg8	6600G>T 	R485L	R485L	missense_variant	rs28399468	C	A	41349732	C	not_revertant	40843827	C	not_revertant	low_impact	snv	normal_function	16.33	no	.	.
cyp2a6	sg9	6586T>C	F480#	F480#	synonymous_variant	rs58537201	A	G	41349746	A	not_revertant	40843841	A	not_revertant	low_impact	snv	.	15.54	no	.	.
cyp2a6	sg10	6582G>T	G479V	G479V	missense_variant	rs5031017	C	A	41349750	C	not_revertant	40843845	C	not_revertant	low_impact	snv	.	24.2	no	.	This SNP is an artifact of the *4 gene deletion. It's located near the left breakpoint.
cyp2a6	sg11	6573A>G	K476R	K476R	missense_variant	rs6413474	T	C	41349759	T	not_revertant	40843854	T	not_revertant	high_impact	snv	decreased_function	14.77	no	.	.
cyp2a6	sg12	6558T>C	I471T	I471T	missense_variant	rs5031016	A	G	41349774	A	not_revertant	40843869	A	not_revertant	high_impact	snv	decreased_function	22.6	no	.	.
cyp2a6	sg13	6531T>C	L462P	L462P	missense_variant	.	A	G	41349801	A	not_revertant	40843896	A	not_revertant	high_impact	snv	decreased_function	22.7	no	.	.
cyp2a6	sg14	6458A>T	N438Y	N438Y	missense_variant	rs143731390	T	A	41349874	T	not_revertant	40843969	T	not_revertant	high_impact	snv	decreased_function	11.4	no	.	.
cyp2a6	sg15	6361C>A	no_effect	no_effect	intron_variant	rs866437607	G	T	41349971	G	not_revertant	40844066	G	not_revertant	low_impact	snv	.	9.712	no	.	.
cyp2a6	sg16	6354T>C	no_effect	no_effect	intron_variant	rs2431413	A	G	41349978	A	not_revertant	40844073	A	not_revertant	low_impact	snv	.	8.499	no	.	.
cyp2a6	sg17	6293T>C	no_effect	no_effect	intron_variant	rs2431414	A	G	41350039	A	not_revertant	40844134	A	not_revertant	low_impact	snv	.	2.353	no	.	.
cyp2a6	sg18	6282A>G	no_effect	no_effect	intron_variant	rs72547581	T	C	41350050	T	not_revertant	40844145	T	not_revertant	low_impact	snv	.	0.918	no	.	.
cyp2a6	sg19	6218A>G	no_effect	no_effect	intron_variant	rs570351602	T	C	41350114	T	not_revertant	40844209	T	not_revertant	low_impact	snv	.	0.706	no	.	.
cyp2a6	sg20	6115C>T	no_effect	no_effect	intron_variant	rs145026630	G	A	41350217	G	not_revertant	40844312	G	not_revertant	low_impact	snv	.	1.182	no	.	.
cyp2a6	sg21	5857T>A	no_effect	no_effect	intron_variant	rs72549446	A	T	41350475	A	not_revertant	40844570	A	not_revertant	low_impact	snv	.	1.331	no	.	.
cyp2a6	sg22	5825A>G	no_effect	no_effect	intron_variant	rs56164728	T	C	41350507	T	not_revertant	40844602	T	not_revertant	low_impact	snv	.	4.248	no	.	.
cyp2a6	sg23	5750G>C	E419D	E419D	missense_variant	rs8192730	C	G	41350582	C	not_revertant	40844677	C	not_revertant	moderate_impact	snv	.	11.18	no	.	.
cyp2a6	sg24	5745A>G 	N418D	N418D	missense_variant	rs28399463	T	C	41350587	T	not_revertant	40844682	T	not_revertant	moderate_impact	snv	.	14.68	no	.	.
cyp2a6	sg25	5738C>T	H415#	H415#	synonymous_variant	rs2002977	G	A	41350594	G	not_revertant	40844689	G	not_revertant	low_impact	snv	.	11.05	no	.	.
cyp2a6	sg26	5717C>T	P408#	P408#	synonymous_variant	rs28399462	G	A	41350615	G	not_revertant	40844710	G	not_revertant	low_impact	snv	.	0.284	no	.	.
cyp2a6	sg27	5684T>C	S397#	S397#	synonymous_variant	rs28399461	A	G	41350648	A	not_revertant	40844743	A	not_revertant	low_impact	snv	.	15.4	no	.	.
cyp2a6	sg28	5668A>T	Y392F	Y392F	missense_variant	rs1809810	T	A	41350664	A	revertant	40844759	T	not_revertant	high_impact	snv	decreased_function	17.42	no	.	.
cyp2a6	sg29	5661G>A	E390K	E390K	missense_variant	rs376817657	C	T	41350671	C	not_revertant	40844766	C	not_revertant	moderate_impact	snv	.	23.3	no	.	.
cyp2a6	sg30	5163G>A	no_effect	no_effect	intron_variant	rs4803380	C	T	41351169	C	not_revertant	40845264	C	not_revertant	low_impact	snv	.	0.127	no	.	.
cyp2a6	sg31	5065G>A	V365M	V365M	missense_variant	rs28399454	C	T	41351267	C	not_revertant	40845362	C	not_revertant	high_impact	snv	decreased_function	8.817	no	.	.
cyp2a6	sg32	5023A>G	Y351H	Y351H	missense_variant	rs148166815	A	G	41351309	A	not_revertant	40845404	A	not_revertant	moderate_impact	snv	unknown_function	25.4	no	.	.
cyp2a6	sg33	4681T>G	no_effect	no_effect	intron_variant	rs56048590	A	C	41351651	A	not_revertant	40845746	A	not_revertant	low_impact	snv	.	0.435	no	.	.
cyp2a6	sg34	4636A>C	no_effect	no_effect	intron_variant	rs72549445	T	G	41351696	T	not_revertant	40845791	T	not_revertant	low_impact	snv	.	1.523	no	.	.
cyp2a6	sg35	4489C>T	no_effect	no_effect	intron_variant	rs28399451	G	A	41351843	G	not_revertant	40845938	G	not_revertant	low_impact	snv	.	0.925	no	.	.
cyp2a6	sg36	4464G>A	E322#	E322#	synonymous_variant	.	C	T	41351868	C	not_revertant	40845963	C	not_revertant	low_impact	snv	.	13.33	no	.	.
cyp2a6	sg37	4406C>T	T303I	T303I	missense_variant	.	G	A	41351926	G	not_revertant	40846021	G	not_revertant	moderate_impact	snv	unknown_function	22.9	no	.	.
cyp2a6	sg38	3872G>A	no_effect	no_effect	intron_variant	rs72549442	C	T	41352460	C	not_revertant	40846555	C	not_revertant	low_impact	snv	.	0.068	no	.	.
cyp2a6	sg39	3524T>C	I268T	I268T	missense_variant	rs763469584	A	G	41352808	A	not_revertant	40846903	A	not_revertant	moderate_impact	snv	unknown_function	24.8	no	.	.
cyp2a6	sg40	3515G>A	R265Q	R265Q	missense_variant	rs140471703	C	T	41352817	C	not_revertant	40846912	C	not_revertant	high_impact	snv	no_function	22.5	no	.	.
cyp2a6	sg41	3492C>T	R257#	R257#	synonymous_variant	rs1809811	G	A	41352840	G	not_revertant	40846935	G	not_revertant	low_impact	snv	.	15.6	no	.	.
cyp2a6	sg42	3391T>C	S224P	S224P	missense_variant	rs28399447	A	G	41352941	A	not_revertant	40847036	A	not_revertant	high_impact	snv	decreased_function	14.66	no	.	.
cyp2a6	sg43	3315C>T	no_effect	no_effect	intron_variant	rs72549441	G	A	41353017	G	not_revertant	40847112	G	not_revertant	low_impact	snv	.	5.1	no	.	.
cyp2a6	sg44	3225A>G	no_effect	no_effect	intron_variant	rs56113850	T	C	41353107	T	not_revertant	40847202	T	not_revertant	low_impact	snv	.	1.127	no	.	.
cyp2a6	sg45	2994T>C	no_effect	no_effect	intron_variant	rs56267346	A	G	41353338	A	not_revertant	40847433	A	not_revertant	low_impact	snv	.	3.53	no	.	.
cyp2a6	sg46	2921G>A	no_effect	no_effect	intron_variant	rs56100930	C	T	41353411	C	not_revertant	40847506	C	not_revertant	low_impact	snv	.	1.782	no	.	.
cyp2a6	sg47	2721G>A	no_effect	no_effect	intron_variant	rs72549440	C	T	41353611	C	not_revertant	40847706	C	not_revertant	low_impact	snv	.	5.8	no	.	.
cyp2a6	sg48	2605G>A	no_effect	no_effect	intron_variant	rs554129636	C	T	41353727	C	not_revertant	40847822	C	not_revertant	low_impact	snv	.	2.237	no	.	.
cyp2a6	sg49	2483G>A	no_effect	no_effect	intron_variant	rs2388868	C	T	41353849	C	not_revertant	40847944	C	not_revertant	low_impact	snv	.	7.999	no	.	.
cyp2a6	sg50	2296C>T	no_effect	no_effect	intron_variant	rs72549439	G	A	41354036	G	not_revertant	40848131	G	not_revertant	low_impact	snv	.	3.714	no	.	.
cyp2a6	sg51	2162_2163GC>A	frameshift	frameshift	frameshift_variant	rs28399445	TGC	TA	41354168	TGC	not_revertant	40848263	TGC	not_revertant	high_impact	indel	no_function	17.55	yes	.	.
cyp2a6	sg52	2161C>T	R203C	R203C	missense_variant	rs56256500	G	A	41354171	G	not_revertant	40848266	G	not_revertant	high_impact	snv	decreased_function	2.088	no	.	.
cyp2a6	sg53	2161C>A	R203S	R203S	missense_variant	rs56256500	G	T	41354171	G	not_revertant	40848266	G	not_revertant	moderate_impact	snv	unknown_function	0.209	no	.	.
cyp2a6	sg54	2141_2142delAA	frameshift	frameshift	frameshift_variant	rs568811809	CTT	C	41354189	CTT	not_revertant	40848284	CTT	not_revertant	high_impact	indel	no_function	24.3	yes	.	.
cyp2a6	sg55	2134A>G	K194E	K194E	missense_variant	rs199916117	T	C	41354198	T	not_revertant	40848293	T	not_revertant	moderate_impact	snv	.	13.26	no	.	.
cyp2a6	sg56	1799T>A	L160H	L160H	missense_variant	rs1801272	A	T	41354533	A	not_revertant	40848628	A	not_revertant	high_impact	snv	no_function	21.9	no	.	.
cyp2a6	sg57	1798C>A	L160I	L160I	missense_variant	rs60563539	G	T	41354534	G	not_revertant	40848629	G	not_revertant	moderate_impact	snv	.	0.162	no	.	.
cyp2a6	sg58	1794C>G	D158E	D158E	missense_variant	rs60605885	G	C	41354538	G	not_revertant	40848633	G	not_revertant	moderate_impact	snv	.	1.977	no	.	.
cyp2a6	sg59	1779G>A	A153#	A153#	synonymous_variant	rs28399441	C	T	41354553	C	not_revertant	40848648	C	not_revertant	low_impact	snv	.	0.885	no	.	.
cyp2a6	sg60	1767C>G	I149M	I149M	missense_variant	.	G	C	41354565	G	not_revertant	40848660	G	not_revertant	high_impact	snv	decreased_function	22.9	no	.	.
cyp2a6	sg61	1711T>G	S131A	S131A	missense_variant	rs59552350	A	C	41354621	A	not_revertant	40848716	A	not_revertant	moderate_impact	snv	.	11.64	no	.	.
cyp2a6	sg62	1710C>T	F130#	F130#	synonymous_variant	rs535832503	G	A	41354622	G	not_revertant	40848717	G	not_revertant	low_impact	snv	.	11.59	no	.	.
cyp2a6	sg63	1703G>T	R128L	R128L	missense_variant	rs4986891	C	A	41354629	C	not_revertant	40848724	C	not_revertant	high_impact	snv	.	20.2	no	.	.
cyp2a6	sg64	1703G>A	R128Q	R128Q	missense_variant	rs4986891	C	T	41354629	C	not_revertant	40848724	C	not_revertant	high_impact	snv	decreased_function	23.2	no	.	.
cyp2a6	sg65	1672T>C	F118L	F118L	missense_variant	rs2839940	A	G	41354660	A	not_revertant	40848755	A	not_revertant	moderate_impact	snv	unknown_function	13.7	no	.	.
cyp2a6	sg66	1620T>C	no_effect	no_effect	intron_variant	rs8192725	A	G	41354712	A	not_revertant	40848807	A	not_revertant	low_impact	snv	.	2.887	no	.	.
cyp2a6	sg67	1339C>G	no_effect	no_effect	intron_variant	rs72549437	G	C	41354993	G	not_revertant	40849088	G	not_revertant	low_impact	snv	.	0.655	no	.	.
cyp2a6	sg68	1165G>A	no_effect	no_effect	intron_variant	rs1226465361	C	T	41355167	C	not_revertant	40849262	C	not_revertant	low_impact	snv	.	8.342	no	.	.
cyp2a6	sg69	1137C>G	no_effect	no_effect	intron_variant	rs7250713	G	C	41355195	G	not_revertant	40849290	G	not_revertant	low_impact	snv	.	4.116	no	.	.
cyp2a6	sg70	768A>T	no_effect	no_effect	intron_variant	rs138920918	T	A	41355564	T	not_revertant	40849659	T	not_revertant	low_impact	snv	.	0.113	no	.	.
cyp2a6	sg71	720G>A	no_effect	no_effect	intron_variant	rs56145769	C	T	41355612	C	not_revertant	40849707	C	not_revertant	low_impact	snv	.	0.319	no	.	.
cyp2a6	sg72	656G>T	no_effect	no_effect	intron_variant	rs72549436	C	A	41355676	C	not_revertant	40849771	C	not_revertant	low_impact	snv	.	0.788	no	.	.
cyp2a6	sg73	594G>C	V110L	V110L	missense_variant	rs72549435	C	G	41355738	C	not_revertant	40849833	C	not_revertant	moderate_impact	snv	.	5.825	no	.	.
cyp2a6	sg74	578A>G	Q104#	Q104#	synonymous_variant	rs72549434	T	C	41355754	T	not_revertant	40849849	T	not_revertant	low_impact	snv	.	2.142	no	.	.
cyp2a6	sg75	.	R101X	R101X	stop_gained	rs199545200	G	A	41355765	G	not_revertant	40849860	G	not_revertant	high_impact	snv	unknown_function	36	yes	.	.
cyp2a6	sg76	507C>T	L81#	L81#	synonymous_variant	rs142692109	G	A	41355825	G	not_revertant	40849920	G	not_revertant	low_impact	snv	.	10.44	no	.	.
cyp2a6	sg77	468G>A	V68M	V68M	missense_variant	rs143690364	C	T	41355864	C	not_revertant	40849959	C	not_revertant	high_impact	snv	decreased_function	22.4	no	.	.
cyp2a6	sg78	209C>T	no_effect	no_effect	intron_variant	rs8192722	G	A	41356123	G	not_revertant	40850218	G	not_revertant	low_impact	snv	.	0.581	no	.	.
cyp2a6	sg79	171C>A	S57#	S57#	synonymous_variant	rs756293343	G	T	41356161	G	not_revertant	40850256	G	not_revertant	low_impact	snv	.	1.405	no	.	.
cyp2a6	sg80	144G>A	Q48#	Q48#	synonymous_variant	rs8192721	C	T	41356188	C	not_revertant	40850283	C	not_revertant	low_impact	snv	.	4.173	no	.	.
cyp2a6	sg81	86G>A	S29N	S29N	missense_variant	rs28399435	C	T	41356246	C	not_revertant	40850341	C	not_revertant	moderate_impact	snv	unknown_function	0.989	no	.	.
cyp2a6	sg82	51G>A	V17#	V17#	synonymous_variant	rs1137115	C	T	41356281	T	revertant	40850376	T	revertant	low_impact	snv	.	0.321	no	.	.
cyp2a6	sg83	22C>T	L8#	L8#	synonymous_variant	rs8192720	G	A	41356310	G	not_revertant	40850405	G	not_revertant	low_impact	snv	.	4.734	no	.	.
cyp2a6	sg84	16A>C	M6L	M6L	missense_variant	rs72549432	T	G	41356316	T	not_revertant	40850411	T	not_revertant	moderate_impact	snv	unknown_function	4.17	no	.	.
cyp2a6	sg85	13G>A	G5R	G5R	missense_variant	rs28399434	C	T	41356319	C	not_revertant	40850414	C	not_revertant	moderate_impact	snv	.	22.4	no	.	.
cyp2a6	sg86	-48T>G	TATA_box	TATA_box	upstream_gene_variant	rs28399433	A	C	41356379	A	not_revertant	40850474	A	not_revertant	high_impact	snv	decreased_function	12.56	no	.	.
cyp2a6	sg87	-492_-470delCCCCTTCCTGAGACCCTTAACCCinsAATCCATATGTGGAATCTG	no_effect	no_effect	upstream_gene_variant	rs386809289	AGGGTTAAGGGTCTCAGGAAGGGG	ACAGATTCCACATATGGATT	41356800	AGGGTTAAGGGTCTCAGGAAGGGG	not_revertant	40850895	AGGGTTAAGGGTCTCAGGAAGGGG	not_revertant	low_impact	indel	.	0.609	no	.	.
cyp2a6	sg88	-745A>G	no_effect	no_effect	upstream_gene_variant	rs61663607	T	C	41357076	T	not_revertant	40851171	T	not_revertant	low_impact	snv	.	1.232	no	.	.
cyp2a6	sg89	-1013A>G	no_effect	no_effect	upstream_gene_variant	rs4803381	T	C	41357344	T	not_revertant	40851439	T	not_revertant	low_impact	snv	.	1.576	no	.	.
cyp2a6	sg90	-1269T>C	no_effect	no_effect	upstream_gene_variant	rs72549429	A	G	41357600	A	not_revertant	40851695	A	not_revertant	low_impact	snv	.	0.533	no	.	.
cyp2a6	sg91	-1289G>A	no_effect	no_effect	upstream_gene_variant	rs7259706	C	T	41357620	C	not_revertant	40851715	C	not_revertant	low_impact	snv	.	4.648	no	.	.
cyp2a6	sg92	-1301A>C	no_effect	no_effect	upstream_gene_variant	rs7260629	T	G	41357632	T	not_revertant	40851727	T	not_revertant	low_impact	snv	.	5.819	no	.	.
cyp2a6	sg93	.	no_effect	no_effect	upstream_gene_variant	rs948668264	T	G	41375653	T	not_revertant	40869748	T	not_revertant	low_impact	snv	.	1.728	no	.	.
cyp2a13	sg1	NG_74G>A	R25Q	R25Q	missense_variant	rs8192784	G	A	41594450	G	not_revertant	41088545	G	not_revertant	moderate_impact	snv	.	13	no	.	.
cyp2a13	sg2	NG_578C>T	R101X	R101X	stop_gained	rs72552266	C	T	41594954	C	not_revertant	41089049	C	not_revertant	high_impact	snv	no_function	35	yes	.	.
cyp2a13	sg3	NG_579G>A	R101Q	R101Q	missense_variant	rs148044792	G	A	41594955	G	not_revertant	41089050	G	not_revertant	moderate_impact	snv	unknown_function	19.61	no	.	.
cyp2a13	sg4	.	no_effect	no_effect	intron_variant	rs113406157	T	C	41595905	T	not_revertant	41090000	T	not_revertant	low_impact	snv	.	6.815	no	.	.
cyp2a13	sg5	NG_1634_1635insACC	133_134insT	133_134insT	inframe_insertion	rs57082577	G	GCCA	41596005	G	not_revertant	41090100	G	not_revertant	moderate_impact	indel	.	14.62	no	.	.
cyp2a13	sg6	NG_1706C>G	D158E	D158E	missense_variant	rs112337232	C	G	41596082	C	not_revertant	41090177	C	not_revertant	moderate_impact	snv	unknown_function	7.754	no	.	.
cyp2a13	sg7	.	no_effect	no_effect	intron_variant	rs1645690	A	G	41596133	A	not_revertant	41090228	A	not_revertant	low_impact	snv	.	8.463	no	.	.
cyp2a13	sg8	.	no_effect	no_effect	intron_variant	rs112900999	G	C	41596177	G	not_revertant	41090272	G	not_revertant	low_impact	snv	.	2.206	no	.	.
cyp2a13	sg9	.	T177#	T177#	synonymous_variant	rs59722942	A	C	41596346	A	not_revertant	41090441	A	not_revertant	low_impact	snv	.	0.032	no	.	.
cyp2a13	sg10	.	no_effect	no_effect	intron_variant	rs8192786	T	C	41596587	T	not_revertant	41090682	T	not_revertant	low_impact	snv	.	4.414	no	.	.
cyp2a13	sg11	.	no_effect	no_effect	intron_variant	rs1811583	C	G	41596838	C	not_revertant	41090933	C	not_revertant	low_impact	snv	.	0.421	no	.	.
cyp2a13	sg12	.	no_effect	no_effect	intron_variant	rs3968433	A	C	41596913	A	not_revertant	41091008	A	not_revertant	low_impact	snv	.	8.623	no	.	.
cyp2a13	sg13	.	no_effect	no_effect	intron_variant	rs3968432	G	A	41596969	G	not_revertant	41091064	G	not_revertant	low_impact	snv	.	2.339	no	.	.
cyp2a13	sg14	.	no_effect	no_effect	intron_variant	rs192721827	G	A	41597302	G	not_revertant	41091397	G	not_revertant	low_impact	snv	.	3.117	no	.	.
cyp2a13	sg15	.	no_effect	no_effect	intron_variant	rs149269648	A	G	41597507	A	not_revertant	41091602	A	not_revertant	low_impact	snv	.	3.355	no	.	.
cyp2a13	sg16	NG_3375C>T	R257C	R257C	missense_variant	rs8192789	C	T	41597751	C	not_revertant	41091846	C	not_revertant	moderate_impact	snv	.	16.21	no	.	.
cyp2a13	sg17	NG_5294G>T	V323L	V323L	missense_variant	.	G	T	41599670	G	not_revertant	41093765	G	not_revertant	moderate_impact	snv	unknown_function	21	no	.	.
cyp2a13	sg18	NG_5792T>C	I331T	I331T	missense_variant	rs761528278	T	C	41600168	T	not_revertant	41094263	T	not_revertant	moderate_impact	snv	.	26.3	no	.	.
cyp2a13	sg19	NG_7343T>A	F453Y	F453Y	missense_variant	rs72547590	T	A	41601719	T	not_revertant	41095814	T	not_revertant	moderate_impact	snv	unknown_function	28.2	no	.	.
cyp2a13	sg20	NG_7465C>T	R494C	R494C	missense_variant	rs138870349	C	T	41601841	C	not_revertant	41095936	C	not_revertant	moderate_impact	snv	unknown_function	23.2	no	.	.
cyp2b6	sg1	NG_-2320T>C	no_effect	no_effect	upstream_gene_variant	rs7254579	T	C	41494891	T	not_revertant	40988986	T	not_revertant	low_impact	snv	.	0.931	no	.	.
cyp2b6	sg2	NG_-1972C>T	no_effect	no_effect	upstream_gene_variant	rs1962261	C	T	41495239	C	not_revertant	40989334	C	not_revertant	low_impact	snv	.	2.933	no	.	.
cyp2b6	sg3	NG_-1848C>A	no_effect	no_effect	upstream_gene_variant	rs139512553	C	A	41495363	C	not_revertant	40989458	C	not_revertant	low_impact	snv	.	1.609	no	.	.
cyp2b6	sg4	NG_-1778A>G	no_effect	no_effect	upstream_gene_variant	rs3760657	A	G	41495433	A	not_revertant	40989528	A	not_revertant	low_impact	snv	.	1.718	no	.	.
cyp2b6	sg5	NG_-1578C>T	no_effect	no_effect	upstream_gene_variant	rs12721652	C	T	41495633	C	not_revertant	40989728	C	not_revertant	low_impact	snv	.	0.058	no	.	.
cyp2b6	sg6	NG_-1456T>C	no_effect	no_effect	upstream_gene_variant	rs2054675	T	C	41495755	T	not_revertant	40989850	T	not_revertant	low_impact	snv	.	0.005	no	.	.
cyp2b6	sg7	NG_-1224A>G	no_effect	no_effect	upstream_gene_variant	rs12721648	A	G	41495987	A	not_revertant	40990082	A	not_revertant	low_impact	snv	.	0.062	no	.	.
cyp2b6	sg8	NG_-1186C>G	no_effect	no_effect	upstream_gene_variant	rs4802100	C	G	41496025	C	not_revertant	40990120	C	not_revertant	low_impact	snv	.	10.34	no	.	.
cyp2b6	sg9	NG_-801G>T	no_effect	no_effect	upstream_gene_variant	rs147862019	G	T	41496410	G	not_revertant	40990505	G	not_revertant	low_impact	snv	.	1.296	no	.	.
cyp2b6	sg10	NG_-757C>T	no_effect	no_effect	upstream_gene_variant	rs12721653	C	T	41496454	C	not_revertant	40990549	C	not_revertant	low_impact	snv	.	0.053	no	.	.
cyp2b6	sg11	NG_-750T>C	no_effect	no_effect	upstream_gene_variant	rs4802101	T	C	41496461	T	not_revertant	40990556	T	not_revertant	low_impact	snv	.	1.932	no	.	.
cyp2b6	sg12	NG_-591A>G	no_effect	no_effect	upstream_gene_variant	rs559553896	A	G	41496620	A	not_revertant	40990715	A	not_revertant	low_impact	snv	.	0.351	no	.	.
cyp2b6	sg13	NG_-82T>C	TATA_box	TATA_box	upstream_gene_variant	rs34223104	T	C	41497129	T	not_revertant	40991224	T	not_revertant	high_impact	snv	increased_function	2.83	no	.	.
cyp2b6	sg14	NG_62A>T	Q21L	Q21L	missense_variant	rs34883432	A	T	41497272	A	not_revertant	40991367	A	not_revertant	moderate_impact	snv	.	0.117	no	.	.
cyp2b6	sg15	NG_64C>T	R22C	R22C	missense_variant	rs8192709	C	T	41497274	C	not_revertant	40991369	C	not_revertant	low_impact	snv	normal_function	9.569	no	.	.
cyp2b6	sg16	NG_76A>T	T26S	T26S	missense_variant	rs33973337	A	T	41497286	A	not_revertant	40991381	A	not_revertant	moderate_impact	snv	.	0.002	no	.	.
cyp2b6	sg17	.	D28G&R29T	D28G&R29T	frameshift_variant	rs781463375	G	GGC	41497292	G	not_revertant	40991387	G	not_revertant	moderate_impact	indel	.	18.82	no	.	The combination of 41497292:G>GGC and 41497294:CCG>G constitutes CYP2B6*17.
cyp2b6	sg18	NG_83A>G	D28G	D28G	missense_variant	rs33980385	A	G	41497293	A	not_revertant	40991388	A	not_revertant	moderate_impact	snv	.	6.998	no	.	.
cyp2b6	sg19	.	D28G&R29T	D28G&R29T	frameshift_variant	rs750679089	CCG	C	41497294	CCG	not_revertant	40991389	CCG	not_revertant	moderate_impact	indel	.	16.32	no	.	The combination of 41497292:G>GGC and 41497294:CCG>G constitutes CYP2B6*17.
cyp2b6	sg20	NG_85C>A	R29S	R29S	missense_variant	rs33926104	C	A	41497295	C	not_revertant	40991390	C	not_revertant	moderate_impact	snv	.	11.37	no	.	.
cyp2b6	sg21	NG_86G>C	R29P	R29P	missense_variant	rs34284776	G	C	41497296	G	not_revertant	40991391	G	not_revertant	moderate_impact	snv	.	13.77	no	.	.
cyp2b6	sg22	.	frameshift	frameshift	frameshift_variant	.	GA	G	41497332	GA	not_revertant	40991427	GA	not_revertant	high_impact	indel	unknown_function	15.36	yes	.	.
cyp2b6	sg23	NG_136A>G	M46V	M46V	missense_variant	rs35303484	A	G	41497346	A	not_revertant	40991441	A	not_revertant	moderate_impact	snv	unknown_function	5.354	no	.	.
cyp2b6	sg24	NG_12710T>A	Y62X	Y62X	stop_gained	rs281864907	T	A	41509920	T	not_revertant	41004015	T	not_revertant	high_impact	snv	.	35	yes	.	.
cyp2b6	sg25	NG_12725G>A	T67#	T67#	synonymous_variant	rs142657251	G	A	41509935	G	not_revertant	41004030	G	not_revertant	low_impact	snv	.	0.26	no	.	.
cyp2b6	sg26	NG_12740G>C	P72#	P72#	synonymous_variant	rs2279341	G	C	41509950	G	not_revertant	41004045	G	not_revertant	low_impact	snv	.	0.139	no	.	.
cyp2b6	sg27	NG_12788T>G	L88#	L88#	synonymous_variant	rs149403002	T	G	41509998	T	not_revertant	41004093	T	not_revertant	low_impact	snv	.	8.747	no	.	.
cyp2b6	sg28	NG_12820G>A	G99E	G99E	missense_variant	rs36060847	G	A	41510030	G	not_revertant	41004125	G	not_revertant	high_impact	snv	no_function	21.3	no	.	.
cyp2b6	sg29	NG_12853G>T	G110V	G110V	missense_variant	rs186335453	G	T	41510063	G	not_revertant	41004158	G	not_revertant	moderate_impact	snv	.	20.2	no	.	.
cyp2b6	sg30	NG_12917A>T	no_effect	no_effect	intron_variant	rs2279342	A	T	41510127	A	not_revertant	41004222	A	not_revertant	low_impact	snv	.	0.395	no	.	.
cyp2b6	sg31	NG_12998T>C	I114T	I114T	missense_variant	rs139801276	T	C	41510208	T	not_revertant	41004303	T	not_revertant	moderate_impact	snv	.	5.421	no	.	.
cyp2b6	sg32	NG_13072A>G	K139E	K139E	missense_variant	rs12721655	A	G	41510282	A	not_revertant	41004377	A	not_revertant	high_impact	snv	no_function	23.6	no	.	.
cyp2b6	sg33	NG_13076G>A	R140Q	R140Q	missense_variant	rs35773040	G	A	41510286	G	not_revertant	41004381	G	not_revertant	moderate_impact	snv	unknown_function	15.94	no	.	.
cyp2b6	sg34	NG_13101G>T	E148D	E148D	missense_variant	rs145884402	G	T	41510311	G	not_revertant	41004406	G	not_revertant	moderate_impact	snv	.	17.18	no	.	.
cyp2b6	sg35	NG_13122G>A	E155#	E155#	synonymous_variant	rs138652715 	G	A	41510332	G	not_revertant	41004427	G	not_revertant	low_impact	snv	.	0.314	no	.	.
cyp2b6	sg36	NG_14593C>G	no_effect	no_effect	intron_variant	rs4803418	C	G	41511803	C	not_revertant	41005898	C	not_revertant	low_impact	snv	.	5.449	no	.	.
cyp2b6	sg37	NG_15582C>T	no_effect	no_effect	intron_variant	rs4803419	C	T	41512792	C	not_revertant	41006887	C	not_revertant	low_impact	snv	.	4.765	no	.	.
cyp2b6	sg38	NG_15614C>G	P167A	P167A	missense_variant	rs3826711	C	G	41512824	C	not_revertant	41006919	C	not_revertant	moderate_impact	snv	.	19.14	no	.	.
cyp2b6	sg39	NG_15618C>T	T168I	T168I	missense_variant	rs36056539	C	T	41512828	C	not_revertant	41006923	C	not_revertant	moderate_impact	snv	.	15.53	no	.	.
cyp2b6	sg40	NG_15631G>T	Q172H	Q172H	missense_variant	rs3745274	G	T	41512841	G	not_revertant	41006936	G	not_revertant	high_impact	snv	decreased_function	0.002	no	.	.
cyp2b6	sg41	NG_15663T>G	V183G	V183G	missense_variant	rs373489637	T	G	41512873	T	not_revertant	41006968	T	not_revertant	moderate_impact	snv	.	24.2	no	.	.
cyp2b6	sg42	NG_15708T>C	M198T	M198T	missense_variant	rs36079186	T	C	41512918	T	not_revertant	41007013	T	not_revertant	moderate_impact	snv	unknown_function	15.85	no	.	.
cyp2b6	sg43	NG_15837C>T	no_effect	no_effect	intron_variant	rs35266616	C	T	41513047	C	not_revertant	41007142	C	not_revertant	low_impact	snv	.	4.403	no	.	.
cyp2b6	sg44	NG_17897C>T	no_effect	no_effect	intron_variant	rs12721646	C	T	41515107	C	not_revertant	41009202	C	not_revertant	low_impact	snv	.	4.433	no	.	.
cyp2b6	sg45	NG_18045C>A	S259R	S259R	missense_variant	rs45482602	C	A	41515255	C	not_revertant	41009350	C	not_revertant	moderate_impact	snv	unknown_function	14.24	no	.	.
cyp2b6	sg46	NG_18053A>G	K262R	K262R	missense_variant	rs2279343	A	G	41515263	A	not_revertant	41009358	A	not_revertant	high_impact	snv	increased_function	0.07	no	.	.
cyp2b6	sg47	NG_18273G>A	no_effect	no_effect	intron_variant	rs2279344	G	A	41515483	G	not_revertant	41009578	G	not_revertant	low_impact	snv	.	0.501	no	.	.
cyp2b6	sg48	NG_18627G>A	no_effect	no_effect	intron_variant	rs12721649	G	A	41515837	G	not_revertant	41009932	G	not_revertant	low_impact	snv	.	4.782	no	.	.
cyp2b6	sg49	NG_18701G>C	A279P	A279P	missense_variant	rs139029625	G	C	41515911	G	not_revertant	41010006	G	not_revertant	moderate_impact	snv	.	1.776	no	.	.
cyp2b6	sg50	NG_18783C>G	T306S	T306S	missense_variant	rs34698757	C	G	41515993	C	not_revertant	41010088	C	not_revertant	moderate_impact	snv	.	25.5	no	.	.
cyp2b6	sg51	NG_18799C>T	F311#	F311#	synonymous_variant	rs35468935	C	T	41516009	C	not_revertant	41010104	C	not_revertant	low_impact	snv	.	11.21	no	.	.
cyp2b6	sg52	NG_18803C>A	L313I	L313I	missense_variant	rs193922917	C	A	41516013	C	not_revertant	41010108	C	not_revertant	low_impact	snv	normal_function	16.02	no	.	.
cyp2b6	sg53	NG_18912G>C	no_effect	no_effect	intron_variant	rs35622401	G	C	41516122	G	not_revertant	41010217	G	not_revertant	low_impact	snv	.	2.166	no	.	.
cyp2b6	sg54	NG_21011T>C	I328T	I328T	missense_variant	rs28399499	T	C	41518221	T	not_revertant	41012316	T	not_revertant	high_impact	snv	no_function	24.6	no	.	.
cyp2b6	sg55	NG_21034C>T	R336C	R336C	missense_variant	rs34826503	C	T	41518244	C	not_revertant	41012339	C	not_revertant	moderate_impact	snv	.	18.98	no	.	.
cyp2b6	sg56	NG_21160C>T	R378X	R378X	stop_gained	rs34097093	C	T	41518370	C	not_revertant	41012465	C	not_revertant	high_impact	snv	.	37	yes	.	.
cyp2b6	sg57	NG_21388T>A	I391N	I391N	missense_variant	rs35979566	T	A	41518598	T	not_revertant	41012693	T	not_revertant	moderate_impact	snv	unknown_function	22.4	no	.	.
cyp2b6	sg58	NG_21435G>A	A407T	A407T	missense_variant	rs193922918	G	A	41518645	G	not_revertant	41012740	G	not_revertant	low_impact	snv	normal_function	0.059	no	.	.
cyp2b6	sg59	NG_21498C>A	P428T	P428T	missense_variant	rs35010098	C	A	41518708	C	not_revertant	41012803	C	not_revertant	moderate_impact	snv	unknown_function	23.8	no	.	.
cyp2b6	sg60	NG_21563C>T	no_effect	no_effect	intron_variant	rs8192719	C	T	41518773	C	not_revertant	41012868	C	not_revertant	low_impact	snv	.	0.11	no	.	.
cyp2b6	sg61	NG_25421A>G	M459V	M459V	missense_variant	rs3211369	A	G	41522631	A	not_revertant	41016726	A	not_revertant	moderate_impact	snv	unknown_function	0.03	no	.	.
cyp2b6	sg62	NG_25473G>A	G476D	G476D	missense_variant	rs564083989	G	A	41522683	G	not_revertant	41016778	G	not_revertant	high_impact	snv	no_function	20.5	no	.	.
cyp2b6	sg63	NG_25500A>T	Q485L	Q485L	missense_variant	.	A	T	41522710	A	not_revertant	41016805	A	not_revertant	moderate_impact	snv	unknown_function	22.5	no	.	.
cyp2b6	sg64	NG_25505C>A	R487S	R487S	missense_variant	rs3211371	C	A	41522715	C	not_revertant	41016810	C	not_revertant	moderate_impact	snv	unknown_function	0.372	no	.	.
cyp2b6	sg65	NG_25505C>T	R487C	R487C	missense_variant	rs3211371	C	T	41522715	C	not_revertant	41016810	C	not_revertant	low_impact	snv	normal_function	0.729	no	.	.
cyp2c8	sg1	NG_32299C>T	no_effect	no_effect	3_prime_UTR_variant	rs1058932	G	A	96796861	G	not_revertant	95037104	G	not_revertant	low_impact	snv	.	0.637	no	.	.
cyp2c8	sg2	NG_32184_32186delTTG	V461del	V461del	inframe_deletion	rs3832694	TCAA	T	96796973	TCAA	not_revertant	95037216	TCAA	not_revertant	moderate_impact	indel	unknown_function	7.335	no	.	.
cyp2c8	sg3	NG_30411A>G	K399R	K399R	missense_variant	 rs10509681	T	C	96798749	T	not_revertant	95038992	T	not_revertant	moderate_impact	snv	.	8.314	no	.	.
cyp2c8	sg4	NG_26513G>T	K383N	K383N	missense_variant	.	C	A	96802647	C	not_revertant	95042890	C	not_revertant	moderate_impact	snv	unknown_function	26.2	no	.	.
cyp2c8	sg5	.	no_effect	no_effect	intron_variant	rs11572162	C	T	96803877	C	not_revertant	95044120	C	not_revertant	low_impact	snv	.	0.269	no	.	.
cyp2c8	sg6	NG_23452G>T	E274X	E274X	stop_gained	rs78637571	C	A	96805708	C	not_revertant	95045951	C	not_revertant	high_impact	snv	no_function	38	yes	.	.
cyp2c8	sg7	.	no_effect	no_effect	intron_variant	rs11572155	T	C	96805986	T	not_revertant	95046229	T	not_revertant	low_impact	snv	.	2.25	no	.	.
cyp2c8	sg8	NG_11054A>T	I269F	I269F	missense_variant	rs11572103	T	A	96818106	T	not_revertant	95058349	T	not_revertant	moderate_impact	snv	unknown_function	23.7	no	.	.
cyp2c8	sg9	NG_11041C>G	I264M	I264M	missense_variant	rs1058930	G	C	96818119	G	not_revertant	95058362	G	not_revertant	moderate_impact	snv	unknown_function	13.32	no	.	.
cyp2c8	sg10	NG_10989A>G	K247R	K247R	missense_variant	rs769460274	T	C	96818171	T	not_revertant	95058414	T	not_revertant	moderate_impact	snv	unknown_function	7.72	no	.	.
cyp2c8	sg11	NG_10961G>C	A238P	A238P	missense_variant	rs188934928	C	G	96818199	C	not_revertant	95058442	C	not_revertant	moderate_impact	snv	unknown_function	0.376	no	.	.
cyp2c8	sg12	NG_10918T>G	I223M	I223M	missense_variant	.	A	C	96818242	A	not_revertant	95058485	A	not_revertant	moderate_impact	snv	unknown_function	0.002	no	.	.
cyp2c8	sg13	NG_4517C>T	R186X	R186X	stop_gained	rs72558195	G	A	96824643	G	not_revertant	95064886	G	not_revertant	high_impact	snv	no_function	41	yes	.	.
cyp2c8	sg14	NG_4517C>G	R186G	R186G	missense_variant	rs72558195	G	C	96824643	G	not_revertant	95064886	G	not_revertant	moderate_impact	snv	unknown_function	24.8	no	.	.
cyp2c8	sg15	NG_4472G>A	G171S	G171S	missense_variant	rs142886225	C	T	96824688	C	not_revertant	95064931	C	not_revertant	moderate_impact	snv	unknown_function	15.6	no	.	.
cyp2c8	sg16	NG_2189delA	frameshift	frameshift	frameshift_variant	rs72558196	GT	G	96826970	GT	not_revertant	95067213	GT	not_revertant	high_impact	indel	no_function	32	yes	.	.
cyp2c8	sg17	NG_2130G>A	R139K	R139K	missense_variant	rs11572080	C	T	96827030	C	not_revertant	95067273	C	not_revertant	moderate_impact	snv	.	19.06	no	.	.
cyp2c8	sg18	NG_-271C>A	no_effect	no_effect	upstream_gene_variant	rs7909236	G	T	96829430	G	not_revertant	95069673	G	not_revertant	low_impact	snv	.	1.23	no	.	.
cyp2c8	sg19	NG_-370T>G	no_effect	no_effect	upstream_gene_variant	rs17110453	A	C	96829529	A	not_revertant	95069772	A	not_revertant	low_impact	snv	.	7.628	no	.	.
cyp2c9	sg1	NG_-3089G>A	no_effect	no_effect	upstream_gene_variant	rs12782374	G	A	96695351	G	not_revertant	94935594	G	not_revertant	low_impact	snv	.	0.237	no	.	.
cyp2c9	sg2	NG_-2663delTG	no_effect	no_effect	upstream_gene_variant	rs71486745	CTG	C	96695774	CTG	not_revertant	94936017	CTG	not_revertant	low_impact	indel	.	0.313	no	.	.
cyp2c9	sg3	NG_-1911T>C	no_effect	no_effect	upstream_gene_variant	rs9332092	T	C	96696529	T	not_revertant	94936772	T	not_revertant	low_impact	snv	.	0.329	no	.	.
cyp2c9	sg4	NG_-1885C>G	no_effect	no_effect	upstream_gene_variant	rs9332093	C	G	96696555	C	not_revertant	94936798	C	not_revertant	low_impact	snv	.	0.228	no	.	.
cyp2c9	sg5	NG_-1766T>C	no_effect	no_effect	upstream_gene_variant	rs9332094	T	C	96696674	T	not_revertant	94936917	T	not_revertant	low_impact	snv	.	2.603	no	.	.
cyp2c9	sg6	NG_-1565C>T	no_effect	no_effect	upstream_gene_variant	rs9332096	C	T	96696875	C	not_revertant	94937118	C	not_revertant	low_impact	snv	.	0.467	no	.	.
cyp2c9	sg7	NG_-1537G>A	no_effect	no_effect	upstream_gene_variant	rs61604699	G	A	96696903	G	not_revertant	94937146	G	not_revertant	low_impact	snv	.	1.688	no	.	.
cyp2c9	sg8	NG_-1188T>C	no_effect	no_effect	upstream_gene_variant	rs4918758	T	C	96697252	T	not_revertant	94937495	T	not_revertant	low_impact	snv	.	0.225	no	.	.
cyp2c9	sg9	NG_-1096A>G	no_effect	no_effect	upstream_gene_variant	rs4917636	A	G	96697344	A	not_revertant	94937587	A	not_revertant	low_impact	snv	.	3.266	no	.	.
cyp2c9	sg10	NG_-981G>A	no_effect	no_effect	upstream_gene_variant	rs9332098	G	A	96697459	G	not_revertant	94937702	G	not_revertant	low_impact	snv	.	3.18	no	.	.
cyp2c9	sg11	NG_-620G>T	no_effect	no_effect	upstream_gene_variant	rs9332100	G	T	96697820	G	not_revertant	94938063	G	not_revertant	low_impact	snv	.	0.242	no	.	.
cyp2c9	sg12	NG_-485T>A	no_effect	no_effect	upstream_gene_variant	rs9332101	T	A	96697955	T	not_revertant	94938198	T	not_revertant	low_impact	snv	.	9.503	no	.	.
cyp2c9	sg13	NG_-484C>A	no_effect	no_effect	upstream_gene_variant	rs9332102	C	A	96697956	C	not_revertant	94938199	C	not_revertant	low_impact	snv	.	9.065	no	.	.
cyp2c9	sg14	NG_1A>G	M1V	M1V	start_lost	rs114071557	A	G	96698440	A	not_revertant	94938683	A	not_revertant	high_impact	snv	no_function	22.5	yes	.	.
cyp2c9	sg15	NG_55C>A	L19I	L19I	missense_variant	rs67807361	C	A	96698494	C	not_revertant	94938737	C	not_revertant	moderate_impact	snv	unknown_function	8.533	no	.	.
cyp2c9	sg16	NG_89C>T	P30L	P30L	missense_variant	rs142240658	C	T	96698528	C	not_revertant	94938771	C	not_revertant	moderate_impact	snv	unknown_function	23.1	no	.	.
cyp2c9	sg17	NG_121A>G	N41D	N41D	missense_variant	.	A	G	96698560	A	not_revertant	94938803	A	not_revertant	moderate_impact	snv	unknown_function	23.3	no	.	.
cyp2c9	sg18	NG_146A>G	D49G	D49G	missense_variant	rs564813580	A	G	96698585	A	not_revertant	94938828	A	not_revertant	moderate_impact	snv	unknown_function	15.92	no	.	.
cyp2c9	sg19	NG_3215G>C	G70R	G70R	missense_variant	rs371055887	G	C	96701654	G	not_revertant	94941897	G	not_revertant	moderate_impact	snv	unknown_function	23.8	no	.	.
cyp2c9	sg20	NG_3233G>A	V76M	V76M	missense_variant	.	G	A	96701672	G	not_revertant	94941915	G	not_revertant	moderate_impact	snv	unknown_function	22	no	.	.
cyp2c9	sg21	NG_3276T>C	L90P	L90P	missense_variant	rs72558187	T	C	96701715	T	not_revertant	94941958	T	not_revertant	high_impact	snv	decreased_function	12.6	no	.	.
cyp2c9	sg22	NG_3294G>C	G96A	G96A	missense_variant	.	G	C	96701733	G	not_revertant	94941976	G	not_revertant	moderate_impact	snv	unknown_function	14.68	no	.	.
cyp2c9	sg23	NG_3300G>T	G98V	G98V	missense_variant	rs762239445	G	T	96701739	G	not_revertant	94941982	G	not_revertant	moderate_impact	snv	unknown_function	22.5	no	.	.
cyp2c9	sg24	NG_3336T>C	F110S	F110S	missense_variant	.	T	C	96701775	T	not_revertant	94942018	T	not_revertant	moderate_impact	snv	unknown_function	0.407	no	.	.
cyp2c9	sg25	NG_3531_3540delAGAAATGGAA	frameshift	frameshift	frameshift_variant	rs1304490498	AAGAAATGGAA	A	96701969	AAGAAATGGAA	not_revertant	94942212	AAGAAATGGAA	not_revertant	high_impact	indel	no_function	25.5	yes	.	.
cyp2c9	sg26	NG_3534A>G	K119R	K119R	missense_variant	rs774607211	A	G	96701973	A	not_revertant	94942216	A	not_revertant	moderate_impact	snv	unknown_function	1.125	no	.	.
cyp2c9	sg27	NG_3548C>T	R124W	R124W	missense_variant	rs767576260	C	T	96701987	C	not_revertant	94942230	C	not_revertant	moderate_impact	snv	unknown_function	22	no	.	.
cyp2c9	sg28	NG_3549G>A	R124Q	R124Q	missense_variant	rs12414460	G	A	96701988	G	not_revertant	94942231	G	not_revertant	high_impact	snv	unknown_function	23.3	no	.	.
cyp2c9	sg29	NG_3551C>T	R125C	R125C	missense_variant	rs375805362	C	T	96701990	C	not_revertant	94942233	C	not_revertant	moderate_impact	snv	unknown_function	24.1	no	.	.
cyp2c9	sg30	NG_3552G>A	R125H	R125H	missense_variant	rs72558189	G	A	96701991	G	not_revertant	94942234	G	not_revertant	moderate_impact	snv	unknown_function	22.6	no	.	.
cyp2c9	sg31	NG_3567C>G	T130R	T130R	missense_variant	rs200965026	C	G	96702006	C	not_revertant	94942249	C	not_revertant	moderate_impact	snv	unknown_function	23	no	.	.
cyp2c9	sg32	NG_3567C>T	T130M	T130M	missense_variant	rs200965026	C	T	96702006	C	not_revertant	94942249	C	not_revertant	moderate_impact	snv	unknown_function	23.3	no	.	.
cyp2c9	sg33	NG_3572C>T	R132W	R132W	missense_variant	rs199523631	C	T	96702011	C	not_revertant	94942254	C	not_revertant	moderate_impact	snv	unknown_function	23.6	no	.	.
cyp2c9	sg34	NG_3573G>A	R132Q	R132Q	missense_variant	rs200183364	G	A	96702012	G	not_revertant	94942255	G	not_revertant	moderate_impact	snv	unknown_function	24.3	no	.	.
cyp2c9	sg35	NG_3608C>T	R144C	R144C	missense_variant	rs1799853	C	T	96702047	C	not_revertant	94942290	C	not_revertant	high_impact	snv	decreased_function	22.9	no	.	.
cyp2c9	sg36	NG_3623G>A	A149T	A149T	missense_variant	rs754487195	G	A	96702062	G	not_revertant	94942305	G	not_revertant	moderate_impact	snv	unknown_function	22.7	no	.	.
cyp2c9	sg37	NG_3627G>A	R150H	R150H	missense_variant	rs7900194	G	A	96702066	G	not_revertant	94942309	G	not_revertant	high_impact	snv	decreased_function	7.328	no	.	.
cyp2c9	sg38	NG_3627G>T	R150L	R150L	missense_variant	rs7900194	G	T	96702066	G	not_revertant	94942309	G	not_revertant	moderate_impact	snv	unknown_function	6.698	no	.	.
cyp2c9	sg39	NG_9100C>A	S162X	S162X	stop_gained	rs72558190	C	A	96707539	C	not_revertant	94947782	C	not_revertant	high_impact	snv	no_function	35	yes	.	.
cyp2c9	sg40	NG_9103C>T	P163L	P163L	missense_variant	rs774550549	C	T	96707542	C	not_revertant	94947785	C	not_revertant	moderate_impact	snv	unknown_function	24.2	no	.	.
cyp2c9	sg41	NG_9225A>C	N204H	N204H	missense_variant	.	A	C	96707664	A	not_revertant	94947907	A	not_revertant	moderate_impact	snv	unknown_function	13.24	no	.	.
cyp2c9	sg42	NG_9235T>C	I207T	I207T	missense_variant	rs1326630788	T	C	96707674	T	not_revertant	94947917	T	not_revertant	moderate_impact	snv	unknown_function	15.55	no	.	.
cyp2c9	sg43	NG_9256A>T	Q214L	Q214L	missense_variant	.	A	T	96707695	A	not_revertant	94947938	A	not_revertant	moderate_impact	snv	unknown_function	24.8	no	.	.
cyp2c9	sg44	NG_10447A>G	I222V	I222V	missense_variant	.	A	G	96708886	A	not_revertant	94949129	A	not_revertant	moderate_impact	snv	unknown_function	0.018	no	.	.
cyp2c9	sg45	NG_10462C>T	P227S	P227S	missense_variant	.	C	T	96708901	C	not_revertant	94949144	C	not_revertant	moderate_impact	snv	unknown_function	22.7	no	.	.
cyp2c9	sg46	NG_10535A>G	H251R	H251R	missense_variant	rs2256871	A	G	96708974	A	not_revertant	94949217	A	not_revertant	moderate_impact	snv	normal_function	23.1	no	.	.
cyp2c9	sg47	NG_10598A>G	E272G	E272G	missense_variant	rs9332130	A	G	96709037	A	not_revertant	94949280	A	not_revertant	moderate_impact	snv	unknown_function	22.4	no	.	.
cyp2c9	sg48	NG_10601delA	frameshift	frameshift	frameshift_variant	rs9332131	GA	G	96709038	GA	not_revertant	94949281	GA	not_revertant	high_impact	indel	no_function	22.9	yes	.	.
cyp2c9	sg49	NG_33437C>A	P279T	P279T	missense_variant	rs182132442	C	A	96731876	C	not_revertant	94972119	C	not_revertant	moderate_impact	snv	unknown_function	8.418	no	.	.
cyp2c9	sg50	NG_33452A>G	I284V	I284V	missense_variant	.	A	G	96731891	A	not_revertant	94972134	A	not_revertant	moderate_impact	snv	unknown_function	0.002	no	.	.
cyp2c9	sg51	NG_33497A>G	T299A	T299A	missense_variant	rs72558192	A	G	96731936	A	not_revertant	94972179	A	not_revertant	moderate_impact	snv	unknown_function	22.2	no	.	.
cyp2c9	sg52	NG_33498C>G	T299R	T299R	missense_variant	rs988617574	C	G	96731937	C	not_revertant	94972180	C	not_revertant	moderate_impact	snv	unknown_function	23	no	.	.
cyp2c9	sg53	NG_33551C>T	P317S	P317S	missense_variant	rs1237225311	C	T	96731990	C	not_revertant	94972233	C	not_revertant	moderate_impact	snv	unknown_function	24.9	no	.	.
cyp2c9	sg54	.	Q324X	Q324X	stop_gained	rs1454934321	C	T	96740948	C	not_revertant	94981191	C	not_revertant	high_impact	snv	unknown_function	40	yes	.	.
cyp2c9	sg55	NG_42519T>C	I327T	I327T	missense_variant	rs57505750	T	C	96740958	T	not_revertant	94981201	T	not_revertant	high_impact	snv	decreased_function	24.2	no	.	.
cyp2c9	sg56	NG_42542C>T	R335W	R335W	missense_variant	rs28371685	C	T	96740981	C	not_revertant	94981224	C	not_revertant	high_impact	snv	decreased_function	23.6	no	.	.
cyp2c9	sg57	NG_42543G>A	R335Q	R335Q	missense_variant	rs367826293	G	A	96740982	G	not_revertant	94981225	G	not_revertant	moderate_impact	snv	unknown_function	20.9	no	.	.
cyp2c9	sg58	NG_42548C>A	P337T	P337T	missense_variant	rs1274535931	C	A	96740987	C	not_revertant	94981230	C	not_revertant	moderate_impact	snv	unknown_function	23.4	no	.	.
cyp2c9	sg59	NG_42568C>A	S343R	S343R	missense_variant	rs750820937	C	A	96741007	C	not_revertant	94981250	C	not_revertant	moderate_impact	snv	unknown_function	15.42	no	.	.
cyp2c9	sg60	NG_42599G>A	E354K	E354K	missense_variant	rs749060448	G	A	96741038	G	not_revertant	94981281	G	not_revertant	moderate_impact	snv	unknown_function	23.6	no	.	.
cyp2c9	sg61	NG_42614A>C	I359L	I359L	missense_variant	rs1057910	A	C	96741053	A	not_revertant	94981296	A	not_revertant	high_impact	snv	decreased_function	16.9	no	.	.
cyp2c9	sg62	NG_42615T>C	I359T	I359T	missense_variant	rs56165452	T	C	96741054	T	not_revertant	94981297	T	not_revertant	high_impact	snv	decreased_function	19.73	no	.	.
cyp2c9	sg63	NG_42619C>G	D360E	D360E	missense_variant	rs28371686	C	G	96741058	C	not_revertant	94981301	C	not_revertant	high_impact	snv	decreased_function	16.55	no	.	.
cyp2c9	sg64	NG_42620C>A	L361I	L361I	missense_variant	rs1250577724	C	A	96741059	C	not_revertant	94981302	C	not_revertant	moderate_impact	snv	unknown_function	8.998	no	.	.
cyp2c9	sg65	NG_42683C>T	P382S	P382S	missense_variant	.	C	T	96741122	C	not_revertant	94981365	C	not_revertant	moderate_impact	snv	unknown_function	23.1	no	.	.
cyp2c9	sg66	NG_42686A>T	K383X	K383X	stop_gained	rs756250160	A	T	96741125	A	not_revertant	94981368	A	not_revertant	high_impact	snv	unknown_function	38	yes	.	.
cyp2c9	sg67	NG_47360A>G	I387V	I387V	missense_variant	rs764211126	A	G	96745799	A	not_revertant	94986042	A	not_revertant	moderate_impact	snv	unknown_function	5.564	no	.	.
cyp2c9	sg68	NG_47391A>C	D397A	D397A	missense_variant	rs72558193	A	C	96745830	A	not_revertant	94986073	A	not_revertant	moderate_impact	snv	.	23.4	no	.	.
cyp2c9	sg69	NG_50173A>T	I434F	I434F	missense_variant	.	A	T	96748612	A	not_revertant	94988855	A	not_revertant	moderate_impact	snv	unknown_function	17.73	no	.	.
cyp2c9	sg70	NG_50235G>C	Q454H	Q454H	missense_variant	rs769942899	G	C	96748674	G	not_revertant	94988917	G	not_revertant	moderate_impact	snv	unknown_function	22.7	no	.	.
cyp2c9	sg71	NG_50243A>G	N457S	N457S	missense_variant	rs202201137	A	G	96748682	A	not_revertant	94988925	A	not_revertant	moderate_impact	snv	.	2.701	no	.	.
cyp2c9	sg72	NG_50273T>C	L467P	L467P	missense_variant	rs767284820	T	C	96748712	T	not_revertant	94988955	T	not_revertant	moderate_impact	snv	unknown_function	22.2	no	.	.
cyp2c9	sg73	NG_50298A>T	G475#	G475#	synonymous_variant	rs1057911	A	T	96748737	A	not_revertant	94988980	A	not_revertant	low_impact	snv	.	0.415	no	.	.
cyp2c9	sg74	NG_50302G>A	A477T	A477T	missense_variant	rs781583846	G	A	96748741	G	not_revertant	94988984	G	not_revertant	moderate_impact	snv	unknown_function	11.04	no	.	.
cyp2c9	sg75	NG_50338C>T	P489S	P489S	missense_variant	rs9332239	C	T	96748777	C	not_revertant	94989020	C	not_revertant	high_impact	snv	decreased_function	21.5	no	.	.
cyp2c9	sg76	NG_50341G>T	V490F	V490F	missense_variant	rs868182778	G	T	96748780	G	not_revertant	94989023	G	not_revertant	moderate_impact	snv	unknown_function	11.44	no	.	.
cyp2c9	sg77	NG_50413C>T	no_effect	no_effect	3_prime_UTR_variant	rs9332240	C	T	96748852	C	not_revertant	94989095	C	not_revertant	low_impact	snv	.	0.756	no	.	.
cyp2c9	sg78	NG_50434C>T	no_effect	no_effect	3_prime_UTR_variant	rs9332241	C	T	96748873	C	not_revertant	94989116	C	not_revertant	low_impact	snv	.	0.69	no	.	.
cyp2c9	sg79	NG_50454C>G	no_effect	no_effect	3_prime_UTR_variant	rs9332242	C	G	96748893	C	not_revertant	94989136	C	not_revertant	low_impact	snv	.	1.299	no	.	.
cyp2c9	sg80	NG_50501C>T	no_effect	no_effect	3_prime_UTR_variant	rs9332243	C	T	96748940	C	not_revertant	94989183	C	not_revertant	low_impact	snv	.	0.361	no	.	.
cyp2c19	sg1	NG_-3402C>T	no_effect	no_effect	upstream_gene_variant	rs11188072	C	T	96519061	C	not_revertant	94759304	C	not_revertant	low_impact	snv	.	0.306	no	.	.
cyp2c19	sg2	NG_-2030C>T	no_effect	no_effect	upstream_gene_variant	rs113164681	C	T	96520433	C	not_revertant	94760676	C	not_revertant	low_impact	snv	.	0.277	no	.	.
cyp2c19	sg3	NG_-2020C>A	no_effect	no_effect	upstream_gene_variant	rs111490789	C	A	96520443	C	not_revertant	94760686	C	not_revertant	low_impact	snv	.	1.024	no	.	.
cyp2c19	sg4	NG_-1439T>C	no_effect	no_effect	upstream_gene_variant	rs17878739	T	C	96521024	T	not_revertant	94761267	T	not_revertant	low_impact	snv	.	0.524	no	.	.
cyp2c19	sg5	NG_-1418C>T	no_effect	no_effect	upstream_gene_variant	rs3814637	C	T	96521045	C	not_revertant	94761288	C	not_revertant	low_impact	snv	.	4.433	no	.	.
cyp2c19	sg6	NG_-1041G>A	no_effect	no_effect	upstream_gene_variant	rs7902257	G	A	96521422	A	revertant	94761665	G	not_revertant	low_impact	snv	.	1	no	.	.
cyp2c19	sg7	NG_-913G>A	no_effect	no_effect	upstream_gene_variant	rs76822098	G	A	96521550	G	not_revertant	94761793	G	not_revertant	low_impact	snv	.	1.942	no	.	.
cyp2c19	sg8	NG_-889T>G	no_effect	no_effect	upstream_gene_variant	rs11568732	T	G	96521574	T	not_revertant	94761817	T	not_revertant	low_impact	snv	.	0.114	no	.	.
cyp2c19	sg9	NG_-806C>T	no_effect	no_effect	upstream_gene_variant	rs12248560	C	T	96521657	C	not_revertant	94761900	C	not_revertant	high_impact	snv	increased_function	0.576	no	.	.
cyp2c19	sg10	NG_-98T>C	no_effect	no_effect	upstream_gene_variant	rs4986894	T	C	96522365	T	not_revertant	94762608	T	not_revertant	low_impact	snv	.	1.088	no	.	.
cyp2c19	sg11	NG_-13G>A	no_effect	no_effect	5_prime_UTR_variant	rs367543001	G	A	96522450	G	not_revertant	94762693	G	not_revertant	low_impact	snv	.	4.667	no	.	.
cyp2c19	sg12	NG_1A>G	M1V	M1V	start_lost	rs28399504	A	G	96522463	A	not_revertant	94762706	A	not_revertant	high_impact	snv	no_function	14.54	yes	.	.
cyp2c19	sg13	NG_7C>T	P3S	P3S	missense_variant	rs367543002	C	T	96522469	C	not_revertant	94762712	C	not_revertant	moderate_impact	snv	.	5.81	no	.	.
cyp2c19	sg14	NG_10T>C	F4L	F4L	missense_variant	rs367543003	T	C	96522472	T	not_revertant	94762715	T	not_revertant	moderate_impact	snv	.	0.006	no	.	.
cyp2c19	sg15	NG_50T>C	L17P	L17P	missense_variant	rs55752064	T	C	96522512	T	not_revertant	94762755	T	not_revertant	moderate_impact	snv	unknown_function	17.43	no	.	.
cyp2c19	sg16	NG_55A>C	I19L	I19L	missense_variant	rs17882687	A	C	96522517	A	not_revertant	94762760	A	not_revertant	low_impact	snv	normal_function	0.021	no	.	.
cyp2c19	sg17	NG_83A>T	K28I	K28I	missense_variant	rs1564656981	A	T	96522545	A	not_revertant	94762788	A	not_revertant	moderate_impact	snv	unknown_function	13.07	no	.	.
cyp2c19	sg18	NG_99C>T	P33#	P33#	synonymous_variant	rs17885098	C	T	96522561	T	revertant	94762804	C	not_revertant	low_impact	snv	.	5.371	no	.	.
cyp2c19	sg19	NG_151A>G	S51G	S51G	missense_variant	rs1564657013	A	G	96522613	A	not_revertant	94762856	A	not_revertant	high_impact	snv	decreased_function	9.976	no	.	.
cyp2c19	sg20	.	no_effect	no_effect	intron_variant	rs182288024	T	C	96527500	T	not_revertant	94767743	T	not_revertant	low_impact	snv	.	2.989	no	.	.
cyp2c19	sg21	.	no_effect	no_effect	intron_variant	rs1006852380	G	A	96532438	G	not_revertant	94772681	G	not_revertant	low_impact	snv	.	1.704	no	.	.
cyp2c19	sg22	NG_12401C>T	R73C	R73C	missense_variant	rs145328984	C	T	96534863	C	not_revertant	94775106	C	not_revertant	moderate_impact	snv	unknown_function	20.3	no	.	.
cyp2c19	sg23	NG_12416C>T	H78Y	H78Y	missense_variant	rs1564660997	C	T	96534878	C	not_revertant	94775121	C	not_revertant	moderate_impact	snv	unknown_function	4.826	no	.	.
cyp2c19	sg24	NG_12455G>C	G91R	G91R	missense_variant	rs118203756	G	C	96534917	G	not_revertant	94775160	G	not_revertant	moderate_impact	snv	unknown_function	22.3	no	.	.
cyp2c19	sg25	NG_12460G>C	E92D	E92D	missense_variant	rs17878459	G	C	96534922	G	not_revertant	94775165	G	not_revertant	moderate_impact	snv	.	6.293	no	.	.
cyp2c19	sg26	NG_12480A>G	H99R	H99R	missense_variant	rs1288601658	A	G	96534942	A	not_revertant	94775185	A	not_revertant	moderate_impact	snv	unknown_function	0.744	no	.	.
cyp2c19	sg27	NG_12662A>G	splicing_defect	splicing_defect	intron_variant	rs12769205	A	G	96535124	A	not_revertant	94775367	A	not_revertant	high_impact	snv	no_function	5.594	yes	.	.
cyp2c19	sg28	NG_12711T>C	W120R	W120R	missense_variant	rs41291556	T	C	96535173	T	not_revertant	94775416	T	not_revertant	high_impact	snv	no_function	24.3	no	.	.
cyp2c19	sg29	NG_12748G>A	R132Q	R132Q	missense_variant	rs72552267	G	A	96535210	G	not_revertant	94775453	G	not_revertant	high_impact	snv	no_function	22	no	.	.
cyp2c19	sg30	NG_12760T>A	M136K	M136K	missense_variant	rs763625282	T	A	96535222	T	not_revertant	94775465	T	not_revertant	moderate_impact	snv	.	23.7	no	.	.
cyp2c19	sg31	NG_12784G>A	R144H	R144H	missense_variant	rs17884712	G	A	96535246	G	not_revertant	94775489	G	not_revertant	high_impact	snv	decreased_function	23.8	no	.	.
cyp2c19	sg32	NG_12802G>A	R150H	R150H	missense_variant	rs58973490	G	A	96535264	G	not_revertant	94775507	G	not_revertant	low_impact	snv	normal_function	3.59	no	.	.
cyp2c19	sg33	NG_12834G>C	A161P	A161P	missense_variant	rs181297724	G	C	96535296	G	not_revertant	94775539	G	not_revertant	moderate_impact	snv	.	22.9	no	.	.
cyp2c19	sg34	NG_17869G>C	R186P	R186P	missense_variant	rs140278421	G	C	96540331	G	not_revertant	94780574	G	not_revertant	high_impact	snv	no_function	23	no	.	.
cyp2c19	sg35	NG_17874G>A	D188N	D188N	missense_variant	rs370803989	G	A	96540336	G	not_revertant	94780579	G	not_revertant	moderate_impact	snv	unknown_function	22	no	.	.
cyp2c19	sg36	NG_17948G>A	W212X	W212X	stop_gained	rs4986893	G	A	96540410	G	not_revertant	94780653	G	not_revertant	high_impact	snv	no_function	35	yes	.	.
cyp2c19	sg37	NG_18911A>G	no_effect	no_effect	intron_variant	rs7088784	A	G	96541373	A	not_revertant	94781616	A	not_revertant	low_impact	snv	.	2.782	yes	.	.
cyp2c19	sg38	NG_19153C>T	P227L	P227L	missense_variant	rs6413438	C	T	96541615	C	not_revertant	94781858	C	not_revertant	high_impact	snv	decreased_function	23.2	no	.	.
cyp2c19	sg39	NG_19154G>A	P227#&splicing_defect	P227#&splicing_defect	synonymous_variant	rs4244285	G	A	96541616	G	not_revertant	94781859	G	not_revertant	high_impact	snv	.	0.075	yes	.	.
cyp2c19	sg40	NG_19239G>A	D256N	D256N	missense_variant	rs375781227	G	A	96541701	G	not_revertant	94781944	G	not_revertant	high_impact	snv	decreased_function	19.24	no	.	.
cyp2c19	sg41	NG_19286G>A	M271I	M271I	missense_variant	rs778258371	G	A	96541748	G	not_revertant	94781991	G	not_revertant	moderate_impact	snv	.	14.86	no	.	.
cyp2c19	sg42	NG_19294T>A	splicing_defect	splicing_defect	splice_donor_variant	rs72558186	T	A	96541756	T	not_revertant	94781999	T	not_revertant	high_impact	snv	no_function	26.1	yes	.	.
cyp2c19	sg43	.	no_effect	no_effect	intron_variant	rs12571421	A	G	96541982	A	not_revertant	94782225	A	not_revertant	low_impact	snv	.	1.906	no	.	.
cyp2c19	sg44	.	no_effect	no_effect	intron_variant	rs973618630	C	T	96544449	C	not_revertant	94784692	C	not_revertant	low_impact	snv	.	4.565	no	.	.
cyp2c19	sg45	.	no_effect	no_effect	intron_variant	rs972452306	T	G	96545322	T	not_revertant	94785565	T	not_revertant	low_impact	snv	.	2.067	no	.	.
cyp2c19	sg46	.	no_effect	no_effect	intron_variant	rs550084092	C	T	96555692	C	not_revertant	94795935	C	not_revertant	low_impact	snv	.	7.167	no	.	.
cyp2c19	sg47	.	no_effect	no_effect	intron_variant	rs1001393638	G	C	96563818	G	not_revertant	94804061	G	not_revertant	low_impact	snv	.	0.444	no	.	.
cyp2c19	sg48	.	no_effect	no_effect	intron_variant	rs11813465	T	C	96571136	T	not_revertant	94811379	T	not_revertant	low_impact	snv	.	0.985	no	.	.
cyp2c19	sg49	.	no_effect	no_effect	intron_variant	rs1017906542	C	T	96575701	C	not_revertant	94815944	C	not_revertant	low_impact	snv	.	0.28	no	.	.
cyp2c19	sg50	.	no_effect	no_effect	intron_variant	rs577628142	G	C	96581618	G	not_revertant	94821861	G	not_revertant	low_impact	snv	.	0.726	no	.	.
cyp2c19	sg51	.	no_effect	no_effect	intron_variant	rs1370021263	T	C	96585525	T	not_revertant	94825768	T	not_revertant	low_impact	snv	.	2.136	no	.	.
cyp2c19	sg52	.	no_effect	no_effect	intron_variant	rs558805878	C	T	96588826	C	not_revertant	94829069	C	not_revertant	low_impact	snv	.	0.283	no	.	.
cyp2c19	sg53	NG_80156G>A	R329H	R329H	missense_variant	rs138142612	G	A	96602618	G	not_revertant	94842861	G	not_revertant	low_impact	snv	normal_function	8.889	no	.	.
cyp2c19	sg54	NG_80160C>T	V330#	V330#	synonymous_variant	rs3758580	C	T	96602622	C	not_revertant	94842865	C	not_revertant	low_impact	snv	.	0.049	no	.	.
cyp2c19	sg55	NG_80161A>G	I331V	I331V	missense_variant	rs3758581	A	G	96602623	G	revertant	94842866	A	not_revertant	low_impact	snv	.	0.001	no	.	.
cyp2c19	sg56	NG_80174G>A	R335Q	R335Q	missense_variant	rs118203757	G	A	96602636	G	not_revertant	94842879	G	not_revertant	high_impact	snv	no_function	22	no	.	.
cyp2c19	sg57	NG_80191G>A	D341N	D341N	missense_variant	rs770829708	G	A	96602653	G	not_revertant	94842896	G	not_revertant	moderate_impact	snv	.	25.6	no	.	.
cyp2c19	sg58	NG_80248G>A	D360N	D360N	missense_variant	rs144036596	G	A	96602710	G	not_revertant	94842953	G	not_revertant	moderate_impact	snv	.	16.94	no	.	.
cyp2c19	sg59	NG_80249A>T	D360V	D360V	missense_variant	rs550527959	A	T	96602711	A	not_revertant	94842954	A	not_revertant	moderate_impact	snv	.	23.8	no	.	.
cyp2c19	sg60	NG_80290G>A	V374I	V374I	missense_variant	rs113934938	G	A	96602752	G	not_revertant	94842995	G	not_revertant	low_impact	snv	.	0.052	no	.	.
cyp2c19	sg61	NG_87248C>G	H396D	H396D	missense_variant	.	C	G	96609710	C	not_revertant	94849953	C	not_revertant	moderate_impact	snv	.	13.84	no	.	.
cyp2c19	sg62	NG_87259A>G	K399#	K399#	synonymous_variant	rs377184510	A	G	96609721	A	not_revertant	94849964	A	not_revertant	low_impact	snv	.	0.077	no	.	.
cyp2c19	sg63	NG_87275G>A	E405K	E405K	missense_variant	rs780225316	G	A	96609737	G	not_revertant	94849980	G	not_revertant	moderate_impact	snv	.	16.38	no	.	.
cyp2c19	sg64	NG_87290C>T	R410C	R410C	missense_variant	rs17879685	C	T	96609752	C	not_revertant	94849995	C	not_revertant	low_impact	snv	normal_function	15.87	no	.	.
cyp2c19	sg65	NG_87313A>C	G417#	G417#	synonymous_variant	rs17886522	A	C	96609775	A	not_revertant	94850018	A	not_revertant	low_impact	snv	.	1.434	no	.	.
cyp2c19	sg66	NG_87323A>C	K421Q	K421Q	missense_variant	.	A	C	96609785	A	not_revertant	94850028	A	not_revertant	moderate_impact	snv	.	23.5	no	.	.
cyp2c19	sg67	NG_90033C>T	R433W	R433W	missense_variant	rs56337013	C	T	96612495	C	not_revertant	94852738	C	not_revertant	high_impact	snv	no_function	24.7	no	.	.
cyp2c19	sg68	NG_90060C>T	R442C	R442C	missense_variant	rs192154563	C	T	96612522	C	not_revertant	94852765	C	not_revertant	high_impact	snv	decreased_function	24.5	no	.	.
cyp2c19	sg69	NG_90080C>G	F448L	F448L	missense_variant	rs118203759	C	G	96612542	C	not_revertant	94852785	C	not_revertant	high_impact	snv	decreased_function	15.9	no	.	.
cyp2c19	sg70	NG_90209A>C	X491C	X491C	stop_lost	rs55640102	A	C	96612671	A	not_revertant	94852914	A	not_revertant	high_impact	snv	unknown_function	1.777	yes	.	.
cyp2d6	sg1	4535insT	no_effect	no_effect	downstream_gene_variant	rs372465406	T	TA	42522257	T	not_revertant	42126255	T	not_revertant	low_impact	indel	.	0.127	no	.	.
cyp2d6	sg2	NG_4482G>A	no_effect	no_effect	downstream_gene_variant	rs12169962	C	T	42522312	T	revertant	42126310	C	not_revertant	low_impact	snv	.	4.534	no	.	.
cyp2d6	sg3	NG_4402C>T	no_effect	no_effect	downstream_gene_variant	rs28371738	G	A	42522392	G	not_revertant	42126390	G	not_revertant	low_impact	snv	.	0.96	no	.	.
cyp2d6	sg4	NG_4214G>A	R497H	R497H	missense_variant	.	C	T	42522580	C	not_revertant	42126578	C	not_revertant	moderate_impact	snv	unknown_function	24	no	.	.
cyp2d6	sg5	NG_4187C>T	S488F	S488F	missense_variant	rs568495591	G	A	42522607	G	not_revertant	42126605	G	not_revertant	moderate_impact	snv	unknown_function	2.484	no	.	.
cyp2d6	sg6	NG_4181G>C	S486T	S486T	missense_variant	rs1135840	C	G	42522613	G	revertant	42126611	C	not_revertant	low_impact	snv	.	1.923	no	.	.
cyp2d6	sg7	NG_4158T>G	H478Q	H478Q	missense_variant	.	A	C	42522636	A	not_revertant	42126634	A	not_revertant	moderate_impact	snv	.	0.244	no	.	.
cyp2d6	sg8	NG_4145G>A	R474Q	R474Q	missense_variant	.	C	T	42522649	C	not_revertant	42126647	C	not_revertant	moderate_impact	snv	.	3.923	no	.	.
cyp2d6	sg9	NG_4133_4134insGTGCCCACT	470_471insVPT	470_471insVPT	inframe_insertion	rs765776661	C	CCAGTGGGCA	42522658	C	not_revertant	42126656	C	not_revertant	high_impact	indel	no_function	13.41	no	.	.
cyp2d6	sg10	NG_4116C>T	F464#	F464#	synonymous_variant	rs150445731	G	A	42522678	G	not_revertant	42126676	G	not_revertant	low_impact	snv	.	15.32	no	.	.
cyp2d6	sg11	NG_4111C>G	H463D	H463D	missense_variant	.	G	C	42522683	G	not_revertant	42126681	G	not_revertant	moderate_impact	snv	unknown_function	22.3	no	.	.
cyp2d6	sg12	NG_4095C>A	F457L	F457L	missense_variant	.	G	T	42522699	G	not_revertant	42126697	G	not_revertant	moderate_impact	snv	unknown_function	27.2	no	.	.
cyp2d6	sg13	NG_4073G>A	R450H	R450H	missense_variant	rs369177208	C	T	42522721	C	not_revertant	42126719	C	not_revertant	moderate_impact	snv	.	26	no	.	.
cyp2d6	sg14	NG_4057G>A	G445R	G445R	missense_variant	rs751092905	C	T	42522737	C	not_revertant	42126735	C	not_revertant	high_impact	snv	unknown_function	31	no	.	.
cyp2d6	sg15	NG_4046G>A	R441H	R441H	missense_variant	rs532668079	C	T	42522748	C	not_revertant	42126746	C	not_revertant	moderate_impact	snv	unknown_function	25.4	no	.	.
cyp2d6	sg16	NG_4045C>T	R441C	R441C	missense_variant	rs730882251	G	A	42522749	G	not_revertant	42126747	G	not_revertant	high_impact	snv	no_function	24.5	no	.	.
cyp2d6	sg17	NG_4043G>A	R440H	R440H	missense_variant	rs267608319	C	T	42522751	C	not_revertant	42126749	C	not_revertant	high_impact	snv	no_function	22.2	no	.	.
cyp2d6	sg18	NG_4040G>A	G439D	G439D	missense_variant	rs569439709	C	T	42522754	C	not_revertant	42126752	C	not_revertant	high_impact	snv	unknown_function	32	no	.	.
cyp2d6	sg19	NG_3915C>T	P430L	P430L	missense_variant	rs3021084	G	A	42522879	G	not_revertant	42126877	G	not_revertant	moderate_impact	snv	.	22	no	.	.
cyp2d6	sg20	NG_3896C>T	Q424X	Q424X	stop_gained	rs763964554	G	A	42522898	G	not_revertant	42126896	G	not_revertant	high_impact	snv	no_function	38	yes	.	.
cyp2d6	sg21	NG_3888T>C	L421P	L421P	missense_variant	rs72549345	A	G	42522906	A	not_revertant	42126904	A	not_revertant	moderate_impact	snv	.	25.5	no	.	.
cyp2d6	sg22	NG_3878G>C	E418Q	E418Q	missense_variant	rs28371733	C	G	42522916	C	not_revertant	42126914	C	not_revertant	moderate_impact	snv	.	23.4	no	.	.
cyp2d6	sg23	NG_3878G>A	E418K	E418K	missense_variant	rs28371733	C	T	42522916	C	not_revertant	42126914	C	not_revertant	moderate_impact	snv	unknown_function	24.3	no	.	.
cyp2d6	sg24	NG_3866C>T	R414C	R414C	missense_variant	rs747089665	G	A	42522928	G	not_revertant	42126926	G	not_revertant	moderate_impact	snv	.	20.6	no	.	.
cyp2d6	sg25	NG_3854G>A	E410K	E410K	missense_variant	rs769157652	C	T	42522940	C	not_revertant	42126938	C	not_revertant	low_impact	snv	normal_function	22	no	.	.
cyp2d6	sg26	NG_3836A>C	K404Q	K404Q	missense_variant	rs267608285	T	G	42522958	T	not_revertant	42126956	T	not_revertant	high_impact	snv	decreased_function	24.1	no	.	.
cyp2d6	sg27	NG_3829G>A	S401#	S401#	synonymous_variant	rs28371732	C	T	42522965	C	not_revertant	42126963	C	not_revertant	low_impact	snv	.	0.253	no	.	.
cyp2d6	sg28	NG_3810_3811insTC	frameshift	frameshift	frameshift_variant	.	G	GGA	42522983	G	not_revertant	42126981	G	not_revertant	high_impact	indel	unknown_function	32	yes	.	.
cyp2d6	sg29	NG_3791C>T	no_effect	no_effect	intron_variant	rs4987144	G	A	42523003	A	revertant	42127001	G	not_revertant	low_impact	snv	.	2.905	no	.	.
cyp2d6	sg30	NG_3610G>T	no_effect	no_effect	intron_variant	rs267608322	C	A	42523184	C	not_revertant	42127182	C	not_revertant	low_impact	snv	.	4.884	no	.	.
cyp2d6	sg31	NG_3585G>A	no_effect	no_effect	intron_variant	rs28371730	C	T	42523209	T	revertant	42127207	C	not_revertant	low_impact	snv	.	0.85	no	.	.
cyp2d6	sg32	NG_3583A>G	no_effect	no_effect	intron_variant	rs2004511	T	C	42523211	T	not_revertant	42127209	T	not_revertant	low_impact	snv	.	0.809	no	.	.
cyp2d6	sg33	NG_3553C>T	no_effect	no_effect	intron_variant	rs879173025	G	A	42523241	G	not_revertant	42127239	G	not_revertant	low_impact	snv	.	0.489	no	.	.
cyp2d6	sg34	NG_3545_3546insA	no_effect	no_effect	intron_variant	rs1269631565	G	GT	42523245	G	not_revertant	42127243	G	not_revertant	low_impact	indel	.	1.425	no	.	.
cyp2d6	sg35	NG_3535G>A	no_effect	no_effect	intron_variant	rs1050232038	C	T	42523259	C	not_revertant	42127257	C	not_revertant	low_impact	snv	.	6.387	no	.	.
cyp2d6	sg36	NG_3492G>A	no_effect	no_effect	intron_variant	rs267608292	C	T	42523302	C	not_revertant	42127300	C	not_revertant	low_impact	snv	.	0.058	no	.	.
cyp2d6	sg37	NG_3485G>A	no_effect	no_effect	intron_variant	rs867985262	C	T	42523309	C	not_revertant	42127307	C	not_revertant	low_impact	snv	.	0.598	no	.	.
cyp2d6	sg38	NG_3479A>G	no_effect	no_effect	intron_variant	rs79596243	T	C	42523315	T	not_revertant	42127313	T	not_revertant	low_impact	snv	.	1.682	no	.	.
cyp2d6	sg39	NG_3436C>A	no_effect	no_effect	intron_variant	rs28371729	G	T	42523358	G	not_revertant	42127356	G	not_revertant	low_impact	snv	.	3.595	no	.	.
cyp2d6	sg40	NG_3385A>C	no_effect	no_effect	intron_variant	rs1985842	T	G	42523409	G	revertant	42127407	T	not_revertant	low_impact	snv	.	0.191	no	.	.
cyp2d6	sg41	NG_3335G>A	R388H	R388H	missense_variant	rs77312092	C	T	42523459	C	not_revertant	42127457	C	not_revertant	moderate_impact	snv	.	13.37	no	.	.
cyp2d6	sg42	NG_3319G>A	E383K	E383K	missense_variant	rs75386357	C	T	42523475	C	not_revertant	42127473	C	not_revertant	moderate_impact	snv	.	16.51	no	.	.
cyp2d6	sg43	.	frameshift	frameshift	frameshift_variant	rs778760893	CGGGATGTCAT	C	42523483	CGGGATGTCAT	not_revertant	42127481	CGGGATGTCAT	not_revertant	high_impact	indel	.	35	yes	.	.
cyp2d6	sg44	NG_3289G>A	G373S	G373S	missense_variant	rs61737946	C	T	42523505	C	not_revertant	42127503	C	not_revertant	moderate_impact	snv	.	15.68	no	.	.
cyp2d6	sg45	NG_3280G>A	V370I	V370I	missense_variant	rs61745683	C	T	42523514	C	not_revertant	42127512	C	not_revertant	moderate_impact	snv	unknown_function	11.73	no	.	.
cyp2d6	sg46	NG_3278T>C	I369T	I369T	missense_variant	rs267608293	A	G	42523516	A	not_revertant	42127514	A	not_revertant	moderate_impact	snv	unknown_function	26.9	no	.	.
cyp2d6	sg47	NG_3269T>C	F366S	F366S	missense_variant	rs1555888910	A	G	42523525	A	not_revertant	42127523	A	not_revertant	moderate_impact	snv	.	27.2	no	.	.
cyp2d6	sg48	NG_3266G>A	R365H	R365H	missense_variant	rs1058172	C	T	42523528	C	not_revertant	42127526	C	not_revertant	high_impact	snv	.	32	no	.	.
cyp2d6	sg49	NG_3260_3261insGT	frameshift	frameshift	frameshift_variant	rs72549346	G	GCA	42523532	G	not_revertant	42127530	G	not_revertant	high_impact	indel	no_function	35	yes	.	.
cyp2d6	sg50	NG_3255T>C	H361#	H361#	synonymous_variant	rs28371726	A	G	42523539	A	not_revertant	42127537	A	not_revertant	low_impact	snv	.	13.18	no	.	.
cyp2d6	sg51	NG_3236A>G	Y355C	Y355C	missense_variant	rs202102799	T	C	42523558	T	not_revertant	42127556	T	not_revertant	moderate_impact	snv	.	20.2	no	.	.
cyp2d6	sg52	NG_3227A>G	H352R	H352R	missense_variant	rs61736517	T	C	42523567	T	not_revertant	42127565	T	not_revertant	moderate_impact	snv	.	2.729	no	.	.
cyp2d6	sg53	NG_3203G>A	R334Q	R334Q	missense_variant	rs76088846	C	T	42523591	C	not_revertant	42127589	C	not_revertant	moderate_impact	snv	unknown_function	10.87	no	.	.
cyp2d6	sg54	NG_3202C>T	R344X	R344X	stop_gained	rs147960066	G	A	42523592	G	not_revertant	42127590	G	not_revertant	high_impact	snv	no_function	35	yes	.	.
cyp2d6	sg55	NG_3199C>G	R343G	R343G	missense_variant	rs267608295	G	C	42523595	G	not_revertant	42127593	G	not_revertant	moderate_impact	snv	unknown_function	23.4	no	.	.
cyp2d6	sg56	NG_3190G>A	G340R	G340R	missense_variant	.	C	T	42523604	C	not_revertant	42127602	C	not_revertant	high_impact	snv	.	30	no	.	.
cyp2d6	sg57	NG_3184G>A	V338M	V338M	missense_variant	rs59421388	C	T	42523610	C	not_revertant	42127608	C	not_revertant	moderate_impact	snv	.	25.5	no	.	.
cyp2d6	sg58	NG_3182A>G	D337G	D337G	missense_variant	rs748712690	T	C	42523612	T	not_revertant	42127610	T	not_revertant	moderate_impact	snv	.	22.6	no	.	.
cyp2d6	sg59	NG_3181G>A	D337N	D337N	missense_variant	rs78209835	C	T	42523613	C	not_revertant	42127611	C	not_revertant	moderate_impact	snv	.	19.08	no	.	.
cyp2d6	sg60	NG_3173A>C	E334A	E334A	missense_variant	rs72549348	T	G	42523621	T	not_revertant	42127619	T	not_revertant	high_impact	snv	no_function	31	no	.	.
cyp2d6	sg61	NG_3161G>C	R330P	R330P	missense_variant	rs141009491	C	G	42523633	C	not_revertant	42127631	C	not_revertant	moderate_impact	snv	unknown_function	24.6	no	.	.
cyp2d6	sg62	NG_3031G>A	no_effect	no_effect	intron_variant	rs267608291	C	T	42523763	C	not_revertant	42127761	C	not_revertant	low_impact	snv	.	3.2	no	.	.
cyp2d6	sg63	NG_2989G>A	splicing_defect	splicing_defect	intron_variant	rs28371725	C	T	42523805	C	not_revertant	42127803	C	not_revertant	high_impact	snv	decreased_function	4.447	yes	.	.
cyp2d6	sg64	NG_2951G>C	splicing_defect	splicing_defect	splice_donor_variant	rs72549349	C	G	42523843	C	not_revertant	42127841	C	not_revertant	high_impact	snv	no_function	28.6	yes	.	.
cyp2d6	sg65	NG_2928_2946delGATCCTACATCCGGATGTG	frameshift	frameshift	frameshift_variant	rs730882170	GCACATCCGGATGTAGGATC	G	42523847	GCACATCCGGATGTAGGATC	not_revertant	42127845	GCACATCCGGATGTAGGATC	not_revertant	high_impact	indel	no_function	34	yes	.	.
cyp2d6	sg66	NG_2940G>A	P325#&splicing_defect	P325#&splicing_defect	synonymous_variant	rs79292917	C	T	42523854	C	not_revertant	42127852	C	not_revertant	high_impact	snv	decreased_function	5.738	yes	.	.
cyp2d6	sg67	NG_2939C>T	P325L	P325L	missense_variant	rs140513104	G	A	42523855	G	not_revertant	42127853	G	not_revertant	moderate_impact	snv	.	25.3	no	.	.
cyp2d6	sg68	NG_2936A>C	H324P	H324P	missense_variant	rs5030867	T	G	42523858	T	not_revertant	42127856	T	not_revertant	high_impact	snv	no_function	24.5	no	.	.
cyp2d6	sg69	NG_2893A>G	T310A	T310A	missense_variant	.	T	C	42523901	T	not_revertant	42127899	T	not_revertant	moderate_impact	snv	unknown_function	22.2	no	.	.
cyp2d6	sg70	NG_2870T>C	L302P	L302P	missense_variant	rs1406719554	A	G	42523924	A	not_revertant	42127922	A	not_revertant	moderate_impact	snv	.	24.7	no	.	.
cyp2d6	sg71	NG_2854A>C	I297L	I297L	missense_variant	.	T	G	42523940	T	not_revertant	42127938	T	not_revertant	moderate_impact	snv	unknown_function	0.079	no	.	.
cyp2d6	sg72	NG_2851C>T	R296C	R296C	missense_variant	rs16947	G	A	42523943	A	revertant	42127941	G	not_revertant	low_impact	snv	normal_function	9.999	no	.	.
cyp2d6	sg73	NG_2829delC	frameshift	frameshift	frameshift_variant	rs267608279	TG	T	42523964	TG	not_revertant	42127962	TG	not_revertant	high_impact	indel	no_function	23.9	yes	.	.
cyp2d6	sg74	NG_2819A>G	N285S	N285S	missense_variant	rs1135829	T	C	42523975	T	not_revertant	42127973	T	not_revertant	moderate_impact	snv	.	16.32	no	.	.
cyp2d6	sg75	NG_2662G>A	no_effect	no_effect	intron_variant	rs76015180	C	T	42524132	C	not_revertant	42128130	C	not_revertant	low_impact	snv	.	2.492	no	.	.
cyp2d6	sg76	NG_2616_2618delAAG	K281del	K281del	inframe_deletion	rs5030656	CCTT	C	42524175	CCTT	not_revertant	42128173	CCTT	not_revertant	high_impact	indel	decreased_function	18.02	no	.	.
cyp2d6	sg77	NG_2611T>A	M279K	M279K	missense_variant	rs201830078	A	T	42524183	A	not_revertant	42128181	A	not_revertant	moderate_impact	snv	.	23.1	no	.	.
cyp2d6	sg78	NG_2607G>A	E278K	E278K	missense_variant	rs77913725	C	T	42524187	C	not_revertant	42128185	C	not_revertant	moderate_impact	snv	.	23.1	no	.	.
cyp2d6	sg79	NG_2603G>T	L276#	L276#	synonymous_variant	rs28371719	C	A	42524191	C	not_revertant	42128189	C	not_revertant	low_impact	snv	.	16.32	no	.	.
cyp2d6	sg80	NG_2588_2591delGACT	frameshift	frameshift	frameshift_variant	rs72549351	CTCAG	C	42524200	CTCAG	not_revertant	42128198	CTCAG	not_revertant	high_impact	indel	no_function	28.2	yes	.	.
cyp2d6	sg81	NG_2580_2581insC	frameshift	frameshift	frameshift_variant	rs72549352	C	CG	42524213	C	not_revertant	42128211	C	not_revertant	high_impact	indel	no_function	33	yes	.	.
cyp2d6	sg82	NG_2580C>T	R269X	R269X	stop_gained	rs367543000	G	A	42524214	G	not_revertant	42128212	G	not_revertant	high_impact	snv	no_function	43	yes	.	.
cyp2d6	sg83	NG_2577C>T	P268S	P268S	missense_variant	rs1473203326	G	A	42524217	G	not_revertant	42128215	G	not_revertant	moderate_impact	snv	.	24.3	no	.	.
cyp2d6	sg84	NG_2576C>A	P267#	P267#	synonymous_variant	rs28371718	G	T	42524218	G	not_revertant	42128216	G	not_revertant	low_impact	snv	.	11.23	no	.	.
cyp2d6	sg85	NG_2575C>A	P267H	P267H	missense_variant	rs148769737	G	T	42524219	G	not_revertant	42128217	G	not_revertant	high_impact	snv	decreased_function	23.6	no	.	.
cyp2d6	sg86	NG_2557C>T	T261I	T261I	missense_variant	rs267608297	G	A	42524237	G	not_revertant	42128235	G	not_revertant	moderate_impact	snv	.	17.92	no	.	.
cyp2d6	sg87	NG_2550delA	frameshift	frameshift	frameshift_variant	rs35742686	CT	C	42524243	CT	not_revertant	42128241	CT	not_revertant	high_impact	indel	no_function	23.4	yes	.	.
cyp2d6	sg88	NG_2540_2543delAACT	frameshift	frameshift	frameshift_variant	rs758320086	CAGTT	C	42524250	CAGTT	not_revertant	42128248	CAGTT	not_revertant	high_impact	indel	no_function	21.8	yes	.	.
cyp2d6	sg89	NG_2520A>C	T249P	T249P	missense_variant	.	T	G	42524274	T	not_revertant	42128272	T	not_revertant	moderate_impact	snv	unknown_function	0.452	no	.	.
cyp2d6	sg90	NG_2484G>T	A237S	A237S	missense_variant	rs28371717	C	A	42524310	C	not_revertant	42128308	C	not_revertant	low_impact	snv	normal_function	0.654	no	.	.
cyp2d6	sg91	NG_2481C>T	L236#	L236#	synonymous_variant	rs267608298	G	A	42524313	G	not_revertant	42128311	G	not_revertant	low_impact	snv	.	0.673	no	.	.
cyp2d6	sg92	NG_2471T>C	H232#	H232#	synonymous_variant	rs17002852	A	G	42524323	A	not_revertant	42128321	A	not_revertant	low_impact	snv	.	11.42	no	.	.
cyp2d6	sg93	NG_2467T>C	L231P	L231P	missense_variant	rs17002853	A	G	42524327	A	not_revertant	42128325	A	not_revertant	moderate_impact	snv	unknown_function	16.74	no	.	.
cyp2d6	sg94	NG_2425C>T	no_effect	no_effect	intron_variant	rs79331140	G	A	42524369	G	not_revertant	42128367	G	not_revertant	low_impact	snv	.	0.138	no	.	.
cyp2d6	sg95	NG_2359A>T	no_effect	no_effect	intron_variant	rs749867663	T	A	42524435	T	not_revertant	42128433	T	not_revertant	low_impact	snv	.	0.14	no	.	.
cyp2d6	sg96	NG_2309G>A	no_effect	no_effect	intron_variant	rs188062577	C	T	42524485	C	not_revertant	42128483	C	not_revertant	low_impact	snv	.	0.063	no	.	.
cyp2d6	sg97	NG_2304C>T	no_effect	no_effect	intron_variant	rs28371715	G	A	42524490	G	not_revertant	42128488	G	not_revertant	low_impact	snv	.	1.213	no	.	.
cyp2d6	sg98	NG_2293G>A	no_effect	no_effect	intron_variant	rs75203276	C	T	42524501	C	not_revertant	42128499	C	not_revertant	low_impact	snv	.	0.195	no	.	.
cyp2d6	sg99	NG_2292G>A	no_effect	no_effect	intron_variant	rs267608300	C	T	42524502	C	not_revertant	42128500	C	not_revertant	low_impact	snv	.	0.305	no	.	.
cyp2d6	sg100	NG_2216A>G	no_effect	no_effect	intron_variant	rs80262685	T	C	42524578	T	not_revertant	42128576	T	not_revertant	low_impact	snv	.	1.063	no	.	.
cyp2d6	sg101	NG_2130A>C	no_effect	no_effect	intron_variant	rs267608290	T	G	42524664	T	not_revertant	42128662	T	not_revertant	low_impact	snv	.	2.754	no	.	.
cyp2d6	sg102	NG_2124C>T	no_effect	no_effect	intron_variant	rs76327133	G	A	42524670	G	not_revertant	42128668	G	not_revertant	low_impact	snv	.	2.226	no	.	.
cyp2d6	sg103	NG_2098A>G	no_effect	no_effect	intron_variant	rs58440431	T	C	42524696	T	not_revertant	42128694	T	not_revertant	low_impact	snv	.	4.752	no	.	.
cyp2d6	sg104	NG_1999T>C	F219#	F219#	synonymous_variant	rs28371713	A	G	42524795	A	not_revertant	42128793	A	not_revertant	low_impact	snv	.	1.609	no	.	.
cyp2d6	sg105	NG_1996delC	frameshift	frameshift	frameshift_variant	.	AG	A	42524797	AG	not_revertant	42128795	AG	not_revertant	high_impact	indel	no_function	17.48	yes	.	.
cyp2d6	sg106	NG_1980T>C	L213P	L213P	missense_variant	rs199535154	A	G	42524814	A	not_revertant	42128812	A	not_revertant	moderate_impact	snv	.	22.1	no	.	.
cyp2d6	sg107	NG_1979C>T	L213#	L213#	synonymous_variant	rs150163869	G	A	42524815	G	not_revertant	42128813	G	not_revertant	low_impact	snv	.	0.589	no	.	.
cyp2d6	sg108	NG_1977G>A	G212E	G212E	missense_variant	rs5030866	C	T	42524817	C	not_revertant	42128815	C	not_revertant	moderate_impact	snv	.	0.016	no	.	.
cyp2d6	sg109	NG_1977_1978insG	frameshift	frameshift	frameshift_variant	rs72549354	T	TC	42524820	T	not_revertant	42128818	T	not_revertant	high_impact	indel	no_function	18.5	yes	.	.
cyp2d6	sg110	NG_1944G>A	R201H	R201H	missense_variant	rs745365204	C	T	42524850	C	not_revertant	42128848	C	not_revertant	moderate_impact	snv	.	9.481	no	.	.
cyp2d6	sg111	NG_1913T>C	C191L	C191L	missense_variant	.	A	G	42524881	A	not_revertant	42128879	A	not_revertant	moderate_impact	snv	unknown_function	13.88	no	.	.
cyp2d6	sg112	NG_1888_1889insTA	S183X	S183X	stop_gained	.	T	TTA	42524905	T	not_revertant	42128903	T	not_revertant	high_impact	indel	no_function	21.1	yes	.	.
cyp2d6	sg113	NG_1870T>C	G176#	G176#	synonymous_variant	rs111606937	A	G	42524924	A	not_revertant	42128922	A	not_revertant	low_impact	snv	.	1.56	no	.	.
cyp2d6	sg114	NG_1864_1865insTTTCGCCCC	174_175insFRP	174_175insFRP	inframe_insertion	rs553846709	T	TGGGGCGAAA	42524929	T	not_revertant	42128927	T	not_revertant	moderate_impact	indel	unknown_function	10.72	no	.	.
cyp2d6	sg115	NG_1864_1865insTTTCGCCCCTTTCGCCCC	174_175insFRPFRP	174_175insFRPFRP	inframe_insertion	rs553846709	T	TGGGGCGAAAGGGGCGAAA	42524929	T	not_revertant	42128927	T	not_revertant	high_impact	indel	.	10.43	no	.	.
cyp2d6	sg116	NG_1859C>T	R173C	R173C	missense_variant	rs370249680	G	A	42524935	G	not_revertant	42128933	G	not_revertant	moderate_impact	snv	.	15.84	no	.	.
cyp2d6	sg117	NG_1847G>A	splicing_defect	splicing_defect	splice_acceptor_variant	rs3892097	C	T	42524947	C	not_revertant	42128945	C	not_revertant	high_impact	snv	no_function	25.1	yes	.	.
cyp2d6	sg118	NG_1791A>G	no_effect	no_effect	intron_variant	rs76326664	T	C	42525003	T	not_revertant	42129001	T	not_revertant	low_impact	snv	.	7.01	no	.	.
cyp2d6	sg119	NG_1784A>C	no_effect	no_effect	intron_variant	rs200002499	T	G	42525010	T	not_revertant	42129008	T	not_revertant	low_impact	snv	.	1.29	no	.	.
cyp2d6	sg120	NG_1759G>T	G169X	G169X	stop_gained	rs5030865	C	A	42525035	C	not_revertant	42129033	C	not_revertant	high_impact	snv	no_function	38	yes	.	.
cyp2d6	sg121	NG_1759G>A	G169R	G169R	missense_variant	rs5030865	C	T	42525035	C	not_revertant	42129033	C	not_revertant	high_impact	snv	decreased_function	24	no	.	.
cyp2d6	sg122	NG_1758C>T	S168#	S168#	synonymous_variant	rs199849357	G	A	42525036	G	not_revertant	42129034	G	not_revertant	low_impact	snv	.	2.887	no	.	.
cyp2d6	sg123	NG_1756T>G	S168A	S168A	missense_variant	rs1135826	A	C	42525038	A	not_revertant	42129036	A	not_revertant	moderate_impact	snv	.	2.995	no	.	.
cyp2d6	sg124	NG_1755C>A	H167Q	H167Q	missense_variant	rs1135825	G	T	42525039	G	not_revertant	42129037	G	not_revertant	moderate_impact	snv	.	0.048	no	.	.
cyp2d6	sg125	NG_1750A>G	N166D	N166D	missense_variant	rs1135824	T	C	42525044	T	not_revertant	42129042	T	not_revertant	moderate_impact	snv	.	6.642	no	.	.
cyp2d6	sg126	NG_1736G>C	C161S	C161S	missense_variant	rs774943042	C	G	42525058	C	not_revertant	42129056	C	not_revertant	moderate_impact	snv	.	21.2	no	.	.
cyp2d6	sg127	NG_1725C>T	A157#	A157#	synonymous_variant	rs74962936	G	A	42525069	G	not_revertant	42129067	G	not_revertant	low_impact	snv	.	9.274	no	.	.
cyp2d6	sg128	NG_1721A>T	E156V	E156V	missense_variant	rs267608302	T	A	42525073	T	not_revertant	42129071	T	not_revertant	moderate_impact	snv	.	23.6	no	.	.
cyp2d6	sg129	NG_1721A>C	E156A	E156A	missense_variant	rs267608302	T	G	42525073	T	not_revertant	42129071	T	not_revertant	high_impact	snv	decreased_function	23.3	no	.	.
cyp2d6	sg130	NG_1717G>A	E155K	E155K	missense_variant	rs28371710	C	T	42525077	C	not_revertant	42129075	C	not_revertant	low_impact	snv	.	13.36	no	.	.
cyp2d6	sg131	NG_1708delT	frameshift	frameshift	frameshift_variant	rs5030655	CA	C	42525085	CA	not_revertant	42129083	CA	not_revertant	high_impact	indel	no_function	22.7	yes	.	.
cyp2d6	sg132	NG_1705C>G	Q151E	Q151E	missense_variant	rs78482768	G	C	42525089	G	not_revertant	42129087	G	not_revertant	moderate_impact	snv	.	11.17	no	.	.
cyp2d6	sg133	NG_1694A>G	K147R	K147R	missense_variant	rs569229126	T	C	42525100	T	not_revertant	42129098	T	not_revertant	moderate_impact	snv	unknown_function	16.14	no	.	.
cyp2d6	sg134	NG_1679T>C	L142S	L142S	missense_variant	rs375135093	A	G	42525115	A	not_revertant	42129113	A	not_revertant	moderate_impact	snv	unknown_function	23.7	no	.	.
cyp2d6	sg135	NG_1662G>C	V136#	V136#	synonymous_variant	rs1058164	C	G	42525132	G	revertant	42129130	C	not_revertant	low_impact	snv	.	2.821	no	.	.
cyp2d6	sg136	NG_1660G>A	V136M	V136M	missense_variant	rs61736512	C	T	42525134	C	not_revertant	42129132	C	not_revertant	moderate_impact	snv	unknown_function	3.968	no	.	.
cyp2d6	sg137	NG_1658C>T	S135F	S135F	missense_variant	rs781457579	G	A	42525136	G	not_revertant	42129134	G	not_revertant	moderate_impact	snv	.	23.8	no	.	.
cyp2d6	sg138	NG_1637G>A	W128X	W128X	stop_gained	.	C	T	42525157	C	not_revertant	42129155	C	not_revertant	high_impact	snv	.	45	yes	.	.
cyp2d6	sg139	NG_1618G>T	A122S	A122S	missense_variant	rs1135823	C	A	42525176	C	not_revertant	42129174	C	not_revertant	low_impact	snv	.	15.38	no	.	.
cyp2d6	sg140	NG_1612T>A	F120I	F120I	missense_variant	rs1135822	A	T	42525182	A	not_revertant	42129180	A	not_revertant	low_impact	snv	.	0.214	no	.	.
cyp2d6	sg141	NG_1609G>A	V119M	V119M	missense_variant	rs374616348	C	T	42525185	C	not_revertant	42129183	C	not_revertant	moderate_impact	snv	.	5.535	no	.	.
cyp2d6	sg142	NG_1599A>G	no_effect	no_effect	intron_variant	rs267608305	T	C	42525195	T	not_revertant	42129193	T	not_revertant	low_impact	snv	.	0.515	no	.	.
cyp2d6	sg143	NG_1514C>T	no_effect	no_effect	intron_variant	rs67497403	G	A	42525280	G	not_revertant	42129278	G	not_revertant	low_impact	snv	.	3.046	no	.	.
cyp2d6	sg144	NG_1495T>C	no_effect	no_effect	intron_variant	rs267608306	A	G	42525299	A	not_revertant	42129297	A	not_revertant	low_impact	snv	.	1.592	no	.	.
cyp2d6	sg145	NG_1279A>C	no_effect	no_effect	intron_variant	rs530100977	T	G	42525515	T	not_revertant	42129513	T	not_revertant	low_impact	snv	.	0.026	no	.	.
cyp2d6	sg146	NG_1169G>A	no_effect	no_effect	intron_variant	rs1081004	C	T	42525625	C	not_revertant	42129623	C	not_revertant	low_impact	snv	.	3.853	no	.	.
cyp2d6	sg147	NG_1061A>G	no_effect	no_effect	intron_variant	rs267608289	T	C	42525733	T	not_revertant	42129731	T	not_revertant	low_impact	snv	.	3.525	no	.	.
cyp2d6	sg148	NG_1038C>T	F112#	F112#	synonymous_variant	rs1081003	G	A	42525756	G	not_revertant	42129754	G	not_revertant	low_impact	snv	.	1.379	no	.	.
cyp2d6	sg149	NG_1035T>C	G111#	G111#	synonymous_variant	rs1135821	A	G	42525759	A	not_revertant	42129757	A	not_revertant	low_impact	snv	.	0.615	no	.	.
cyp2d6	sg150	NG_1033G>A	G111S	G111S	missense_variant	rs535642512	C	T	42525761	C	not_revertant	42129759	C	not_revertant	moderate_impact	snv	.	23.3	no	.	.
cyp2d6	sg151	NG_1027A>G	I109V	I109V	missense_variant	rs78459009	T	C	42525767	T	not_revertant	42129765	T	not_revertant	moderate_impact	snv	.	1.01	no	.	.
cyp2d6	sg152	NG_1022C>T	T107I	T107I	missense_variant	rs28371706	G	A	42525772	G	not_revertant	42129770	G	not_revertant	high_impact	snv	decreased_function	0.788	no	.	.
cyp2d6	sg153	NG_1022C>A	T107N	T107N	missense_variant	rs28371706	G	T	42525772	G	not_revertant	42129770	G	not_revertant	moderate_impact	snv	.	0.572	no	.	.
cyp2d6	sg154	NG_1021A>T	T107S	T107S	missense_variant	rs74802369	T	A	42525773	T	not_revertant	42129771	T	not_revertant	moderate_impact	snv	.	1.894	no	.	.
cyp2d6	sg155	NG_1013T>C	V104A	V104A	missense_variant	rs76187628	A	G	42525781	A	not_revertant	42129779	A	not_revertant	moderate_impact	snv	.	0.502	no	.	.
cyp2d6	sg156	NG_1012G>A	V104M	V104M	missense_variant	rs267608308	C	T	42525782	C	not_revertant	42129780	C	not_revertant	moderate_impact	snv	unknown_function	1.062	no	.	.
cyp2d6	sg157	NG_996C>G	T98#	T98#	synonymous_variant	rs28371705	G	C	42525798	G	not_revertant	42129796	G	not_revertant	low_impact	snv	.	0.052	no	.	.
cyp2d6	sg158	NG_983A>G	H94R	H94R	missense_variant	rs28371704	T	C	42525811	T	not_revertant	42129809	T	not_revertant	moderate_impact	snv	.	3.773	no	.	.
cyp2d6	sg159	NG_973C>A	L91M	L91M	missense_variant	rs28371703	G	T	42525821	G	not_revertant	42129819	G	not_revertant	moderate_impact	snv	.	22.2	no	.	.
cyp2d6	sg160	NG_971C>T	A90V	A90V	missense_variant	rs267608309	G	A	42525823	G	not_revertant	42129821	G	not_revertant	low_impact	snv	normal_function	17.23	no	.	.
cyp2d6	sg161	NG_965G>C	R88P	R88P	missense_variant	rs267608276	C	G	42525829	C	not_revertant	42129827	C	not_revertant	high_impact	snv	.	23.7	no	.	.
cyp2d6	sg162	NG_956C>T	A85V	A85V	missense_variant	rs267608310	G	A	42525838	G	not_revertant	42129836	G	not_revertant	moderate_impact	snv	unknown_function	7.765	no	.	.
cyp2d6	sg163	NG_905T>C	V68G	V68G	missense_variant	.	A	G	42525889	A	not_revertant	42129887	A	not_revertant	moderate_impact	snv	.	25.6	no	.	.
cyp2d6	sg164	NG_886C>T	R62W	R62W	missense_variant	rs267608311	G	A	42525908	G	not_revertant	42129906	G	not_revertant	high_impact	snv	.	22.9	no	.	.
cyp2d6	sg165	NG_882G>C	splicing_defect	splicing_defect	splice_acceptor_variant	rs201377835	C	G	42525912	C	not_revertant	42129910	C	not_revertant	high_impact	snv	no_function	26.4	yes	.	.
cyp2d6	sg166	NG_842T>G	no_effect	no_effect	intron_variant	rs28371702	A	C	42525952	C	revertant	42129950	A	not_revertant	low_impact	snv	.	0.961	no	.	.
cyp2d6	sg167	NG_745C>G	no_effect	no_effect	intron_variant	rs28371701	G	C	42526049	C	revertant	42130047	G	not_revertant	low_impact	snv	.	2.243	no	.	.
cyp2d6	sg168	NG_743delC	no_effect	no_effect	intron_variant	rs267608275	TG	T	42526050	TG	not_revertant	42130048	TG	not_revertant	low_impact	indel	.	0.514	no	.	.
cyp2d6	sg169	NG_653C>T	no_effect	no_effect	intron_variant	rs376217512	G	A	42526141	G	not_revertant	42130139	G	not_revertant	low_impact	snv	.	6.773	no	.	.
cyp2d6	sg170	NG_606G>A	no_effect	no_effect	intron_variant	rs575159870	C	T	42526188	C	not_revertant	42130186	C	not_revertant	low_impact	snv	.	1.084	no	.	.
cyp2d6	sg171	601delC	no_effect	no_effect	intron_variant	.	G	GG	42526194	G	not_revertant	42130192	G	not_revertant	low_impact	indel	.	4.69	no	.	.
cyp2d6	sg172	NG_323G>A	no_effect	no_effect	intron_variant	rs35970455	C	T	42526471	C	not_revertant	42130469	C	not_revertant	low_impact	snv	.	3.677	no	.	.
cyp2d6	sg173	NG_317A>G	no_effect	no_effect	intron_variant	rs34291018	T	C	42526477	T	not_revertant	42130475	T	not_revertant	low_impact	snv	.	2.912	no	.	.
cyp2d6	sg174	NG_310G>T	no_effect	no_effect	intron_variant	rs28371699	C	A	42526484	A	revertant	42130482	C	not_revertant	low_impact	snv	.	5.347	no	.	.
cyp2d6	sg175	NG_280G>A	no_effect	no_effect	intron_variant	rs267608273	C	T	42526514	C	not_revertant	42130512	C	not_revertant	low_impact	snv	.	4.325	no	.	.
cyp2d6	sg176	NG_270C>T	no_effect	no_effect	intron_variant	rs29001678	G	A	42526524	G	not_revertant	42130522	G	not_revertant	low_impact	snv	.	6.86	no	.	.
cyp2d6	sg177	NG_245A>G	no_effect	no_effect	intron_variant	rs1081000	T	C	42526549	C	revertant	42130547	T	not_revertant	low_impact	snv	.	4.907	no	.	.
cyp2d6	sg178	NG_233A>C	no_effect	no_effect	intron_variant	rs28695233	T	G	42526561	G	revertant	42130559	T	not_revertant	low_impact	snv	.	1.876	no	.	.
cyp2d6	sg179	NG_232G>C	no_effect	no_effect	intron_variant	rs29001518	C	G	42526562	G	revertant	42130560	C	not_revertant	low_impact	snv	.	1.548	no	.	.
cyp2d6	sg180	NG_227T>C	no_effect	no_effect	intron_variant	rs1080998	A	G	42526567	G	revertant	42130565	A	not_revertant	low_impact	snv	.	0.198	no	.	.
cyp2d6	sg181	NG_223C>G	no_effect	no_effect	intron_variant	rs1080997	G	C	42526571	C	revertant	42130569	G	not_revertant	low_impact	snv	.	2.51	no	.	.
cyp2d6	sg182	NG_221C>A	no_effect	no_effect	intron_variant	rs1080996	G	T	42526573	T	revertant	42130571	G	not_revertant	low_impact	snv	.	1.526	no	.	.
cyp2d6	sg183	NG_214G>C	no_effect	no_effect	intron_variant	rs1080995	C	G	42526580	G	revertant	42130578	C	not_revertant	low_impact	snv	.	3.592	no	.	.
cyp2d6	sg184	137_138insT	frameshift	frameshift	frameshift_variant	rs774671100	C	CA	42526656	C	not_revertant	42130654	C	not_revertant	high_impact	indel	no_function	24.7	yes	.	.
cyp2d6	sg185	NG_125G>A	G42E	G42E	missense_variant	rs118203758	C	T	42526669	C	not_revertant	42130667	C	not_revertant	moderate_impact	snv	unknown_function	16.36	no	.	.
cyp2d6	sg186	NG_124G>A	G42R	G42R	missense_variant	rs5030862	C	T	42526670	C	not_revertant	42130668	C	not_revertant	high_impact	snv	no_function	17.62	no	.	.
cyp2d6	sg187	NG_108C>T	G36#	G36#	synonymous_variant	rs143218187	G	A	42526686	G	not_revertant	42130684	G	not_revertant	low_impact	snv	.	11.15	no	.	.
cyp2d6	sg188	NG_102A>G	P34#	P34#	synonymous_variant	rs151226748	T	C	42526692	T	not_revertant	42130690	T	not_revertant	low_impact	snv	.	0.193	no	.	.
cyp2d6	sg189	NG_100C>T	P34S	P34S	missense_variant	rs1065852	G	A	42526694	G	not_revertant	42130692	G	not_revertant	high_impact	snv	decreased_function	23.7	no	.	.
cyp2d6	sg190	NG_82C>T	R28C	R28C	missense_variant	rs138100349	G	A	42526712	G	not_revertant	42130710	G	not_revertant	moderate_impact	snv	unknown_function	22.8	no	.	.
cyp2d6	sg191	NG_77G>A	R26H	R26H	missense_variant	rs28371696	C	T	42526717	C	not_revertant	42130715	C	not_revertant	low_impact	snv	unknown_function	22.8	no	.	.
cyp2d6	sg192	NG_73C>T	R25W	R25W	missense_variant	rs267608313	G	A	42526721	G	not_revertant	42130719	G	not_revertant	high_impact	snv	.	23.1	no	.	.
cyp2d6	sg193	NG_64delC	L22X	L22X	stop_gained	.	AG	A	42526729	AG	not_revertant	42130727	AG	not_revertant	high_impact	indel	unknown_function	24.7	yes	.	.
cyp2d6	sg194	NG_31G>A	V11M	V11M	missense_variant	rs769258	C	T	42526763	C	not_revertant	42130761	C	not_revertant	low_impact	snv	.	0.844	no	.	.
cyp2d6	sg195	NG_19G>A	V7M	V7M	missense_variant	rs72549358	C	T	42526775	C	not_revertant	42130773	C	not_revertant	moderate_impact	snv	.	3	no	.	.
cyp2d6	sg196	NG_18G>A	L6#	L6#	synonymous_variant	rs148382141	C	T	42526776	C	not_revertant	42130774	C	not_revertant	low_impact	snv	.	10.04	no	.	.
cyp2d6	sg197	NG_14C>T	A5V	A5V	missense_variant	rs773790593	G	A	42526780	G	not_revertant	42130778	G	not_revertant	moderate_impact	snv	.	1.269	no	.	.
cyp2d6	sg198	NG_-44_-43insG	no_effect	no_effect	5_prime_UTR_variant	rs28371695	A	AC	42526836	A	not_revertant	42130834	A	not_revertant	low_impact	indel	.	4.969	no	.	.
cyp2d6	sg199	NG_-138A>G	no_effect	no_effect	upstream_gene_variant	rs267608272	T	C	42526931	T	not_revertant	42130929	T	not_revertant	low_impact	snv	.	10.04	no	.	.
cyp2d6	sg200	NG_-176G>A	no_effect	no_effect	upstream_gene_variant	rs1080993	C	T	42526969	C	not_revertant	42130967	C	not_revertant	low_impact	snv	.	3.756	no	.	.
cyp2d6	sg201	NG_-225A>G	no_effect	no_effect	upstream_gene_variant	rs35481113	T	C	42527018	T	not_revertant	42131016	T	not_revertant	low_impact	snv	.	6.524	no	.	.
cyp2d6	sg202	NG_-227A>G	no_effect	no_effect	upstream_gene_variant	.	T	C	42527020	T	not_revertant	42131018	T	not_revertant	low_impact	snv	.	6.678	no	.	.
cyp2d6	sg203	NG_-232G>C	no_effect	no_effect	upstream_gene_variant	rs35023634	C	G	42527025	C	not_revertant	42131023	C	not_revertant	low_impact	snv	.	2.89	no	.	.
cyp2d6	sg204	NG_-248C>G	no_effect	no_effect	upstream_gene_variant	rs540805349	G	C	42527041	G	not_revertant	42131039	G	not_revertant	low_impact	snv	.	3.228	no	.	.
cyp2d6	sg205	NG_-267G>C	no_effect	no_effect	upstream_gene_variant	.	C	G	42527060	C	not_revertant	42131058	C	not_revertant	low_impact	snv	.	0.74	no	.	.
cyp2d6	sg206	NG_-268G>A	no_effect	no_effect	upstream_gene_variant	.	C	T	42527061	C	not_revertant	42131059	C	not_revertant	low_impact	snv	.	0.149	no	.	.
cyp2d6	sg207	NG_-272C>T	no_effect	no_effect	upstream_gene_variant	rs35046171	G	A	42527065	G	not_revertant	42131063	G	not_revertant	low_impact	snv	.	7.525	no	.	.
cyp2d6	sg208	NG_-275C>T	no_effect	no_effect	upstream_gene_variant	.	G	A	42527068	G	not_revertant	42131066	G	not_revertant	low_impact	snv	.	5.193	no	.	.
cyp2d6	sg209	NG_-276C>T	no_effect	no_effect	upstream_gene_variant	.	G	A	42527069	G	not_revertant	42131067	G	not_revertant	low_impact	snv	.	0.739	no	.	.
cyp2d6	sg210	NG_-320A>G	no_effect	no_effect	upstream_gene_variant	.	T	C	42527113	T	not_revertant	42131111	T	not_revertant	low_impact	snv	.	0.258	no	.	.
cyp2d6	sg211	NG_-321C>G	no_effect	no_effect	upstream_gene_variant	.	G	C	42527114	G	not_revertant	42131112	G	not_revertant	low_impact	snv	.	0.389	no	.	.
cyp2d6	sg212	NG_-327A>G	no_effect	no_effect	upstream_gene_variant	.	T	C	42527120	T	not_revertant	42131118	T	not_revertant	low_impact	snv	.	0.398	no	.	.
cyp2d6	sg213	NG_-328C>T	no_effect	no_effect	upstream_gene_variant	.	G	A	42527121	G	not_revertant	42131119	G	not_revertant	low_impact	snv	.	0.059	no	.	.
cyp2d6	sg214	NG_-331T>G	no_effect	no_effect	upstream_gene_variant	rs34167214	A	C	42527124	A	not_revertant	42131122	A	not_revertant	low_impact	snv	.	0.065	no	.	.
cyp2d6	sg215	NG_-334G>C	no_effect	no_effect	upstream_gene_variant	.	C	G	42527127	C	not_revertant	42131125	C	not_revertant	low_impact	snv	.	0.053	no	.	.
cyp2d6	sg216	NG_-354A>G	no_effect	no_effect	upstream_gene_variant	rs530422334	T	C	42527147	T	not_revertant	42131145	T	not_revertant	low_impact	snv	.	2.218	no	.	.
cyp2d6	sg217	NG_-431C>T	no_effect	no_effect	upstream_gene_variant	rs566383351	G	A	42527224	G	not_revertant	42131222	G	not_revertant	low_impact	snv	.	0.933	no	.	.
cyp2d6	sg218	NG_-629A>G	no_effect	no_effect	upstream_gene_variant	.	T	C	42527422	T	not_revertant	42131420	T	not_revertant	low_impact	snv	.	2.135	no	.	.
cyp2d6	sg219	NG_-678G>A	no_effect	no_effect	upstream_gene_variant	rs28633410	C	T	42527471	T	revertant	42131469	C	not_revertant	low_impact	snv	.	2.72	no	.	.
cyp2d6	sg220	NG_-695_-692delTGTG	no_effect	no_effect	upstream_gene_variant	rs534009571	CCACA	C	42527484	CCACA	not_revertant	42131482	CCACA	not_revertant	low_impact	indel	.	3.033	no	.	.
cyp2d6	sg221	NG_-740C>T	no_effect	no_effect	upstream_gene_variant	rs28624811	G	A	42527533	A	revertant	42131531	G	not_revertant	low_impact	snv	.	2.302	no	.	.
cyp2d6	sg222	NG_-750_-749delGA	no_effect	no_effect	upstream_gene_variant	rs536645539	TTC	T	42527541	TTC	not_revertant	42131539	TTC	not_revertant	low_impact	indel	.	0.373	no	.	.
cyp2d6	sg223	NG_-960G>C	no_effect	no_effect	upstream_gene_variant	rs1080990	C	G	42527753	C	not_revertant	42131751	C	not_revertant	low_impact	snv	.	7.875	no	.	.
cyp2d6	sg224	NG_-1000G>A	no_effect	no_effect	upstream_gene_variant	rs1080989	C	T	42527793	C	not_revertant	42131791	C	not_revertant	low_impact	snv	.	0.162	no	.	.
cyp2d6	sg225	NG_-1011T>C	no_effect	no_effect	upstream_gene_variant	rs59360719	A	G	42527804	A	not_revertant	42131802	A	not_revertant	low_impact	snv	.	8.436	no	.	.
cyp2d6	sg226	NG_-1094_-1093insA	no_effect	no_effect	upstream_gene_variant	rs544534350	A	AT	42527886	A	not_revertant	42131884	A	not_revertant	low_impact	indel	.	1.409	no	.	.
cyp2d6	sg227	NG_-1109C>T	no_effect	no_effect	upstream_gene_variant	rs267608271	G	A	42527902	G	not_revertant	42131900	G	not_revertant	low_impact	snv	.	4.363	no	.	.
cyp2d6	sg228	NG_-1235A>G	no_effect	no_effect	upstream_gene_variant	rs28735595	T	C	42528028	C	revertant	42132026	T	not_revertant	low_impact	snv	.	0.962	no	.	.
cyp2d6	sg229	.	no_effect	no_effect	upstream_gene_variant	.	TTT	T	42528054	TTT	not_revertant	42132047	TTT	not_revertant	low_impact	indel	.	0.72	no	.	.
cyp2d6	sg230	.	no_effect	no_effect	upstream_gene_variant	.	TTT	TTTT	42528054	TTT	not_revertant	42132047	TTT	not_revertant	low_impact	indel	.	0.775	no	.	.
cyp2d6	sg231	.	no_effect	no_effect	upstream_gene_variant	.	TTT	TTTTT	42528054	TTT	not_revertant	42132047	TTT	not_revertant	low_impact	indel	.	0.755	no	.	.
cyp2d6	sg232	NG_-1298G>A	no_effect	no_effect	upstream_gene_variant	rs59099247	C	T	42528096	C	not_revertant	42132089	C	not_revertant	low_impact	snv	.	1.545	no	.	.
cyp2d6	sg233	NG_-1408G>A	no_effect	no_effect	upstream_gene_variant	rs1080987	C	T	42528206	C	not_revertant	42132199	C	not_revertant	low_impact	snv	.	0.019	no	.	.
cyp2d6	sg234	NG_-1418T>A	no_effect	no_effect	upstream_gene_variant	rs1080986	A	T	42528216	A	not_revertant	42132209	A	not_revertant	low_impact	snv	.	0.341	no	.	.
cyp2d6	sg235	NG_-1426C>T	no_effect	no_effect	upstream_gene_variant	rs28588594	G	A	42528224	G	not_revertant	42132217	G	not_revertant	low_impact	snv	.	1.615	no	.	.
cyp2d6	sg236	NG_-1543G>A	no_effect	no_effect	upstream_gene_variant	rs76210340	C	T	42528341	C	not_revertant	42132334	C	not_revertant	low_impact	snv	.	1.687	no	.	.
cyp2d6	sg237	NG_-1584C>G	no_effect	no_effect	upstream_gene_variant	rs1080985	G	C	42528382	C	revertant	42132375	G	not_revertant	low_impact	snv	.	0.199	no	.	.
cyp2d6	sg238	NG_-1594T>C	no_effect	no_effect	upstream_gene_variant	rs1080984	A	G	42528392	A	not_revertant	42132385	A	not_revertant	low_impact	snv	.	3.213	no	.	.
cyp2d6	sg239	NG_-1600A>T	no_effect	no_effect	upstream_gene_variant	rs576829306	T	A	42528398	T	not_revertant	42132391	T	not_revertant	low_impact	snv	.	5.138	no	.	.
cyp2d6	sg240	NG_-1601G>T	no_effect	no_effect	upstream_gene_variant	rs545591749	C	A	42528399	C	not_revertant	42132392	C	not_revertant	low_impact	snv	.	3.785	no	.	.
cyp2e1	sg1	-1293G>C	no_effect	no_effect	upstream_gene_variant	rs3813867	G	C	135339605	G	not_revertant	133526101	G	not_revertant	low_impact	snv	.	0.228	no	.	.
cyp2e1	sg2	-1053C>T	no_effect	no_effect	upstream_gene_variant	rs2031920	C	T	135339845	C	not_revertant	133526341	C	not_revertant	low_impact	snv	.	0.311	no	.	.
cyp2e1	sg3	-352A>G	no_effect	no_effect	upstream_gene_variant	.	A	G	135340548	A	not_revertant	133527044	A	not_revertant	low_impact	snv	.	2.592	no	.	.
cyp2e1	sg4	-333T>A	no_effect	no_effect	upstream_gene_variant	rs2070673	T	A	135340567	A	revertant	133527063	A	revertant	low_impact	snv	unknown_function	4.017	no	.	.
cyp2e1	sg5	-71G>T	no_effect	no_effect	upstream_gene_variant	.	G	T	135340829	G	not_revertant	133527325	G	not_revertant	low_impact	snv	.	1.682	no	.	.
cyp2e1	sg6	.	no_effect	no_effect	5_prime_UTR_variant	rs11445593	T	TC	135340866	T	not_revertant	133527362	T	not_revertant	low_impact	snv	.	5.057	no	.	.
cyp2e1	sg7	1132G>A	R76H	R76H	missense_variant	rs72559710	G	A	135342034	G	not_revertant	133528530	G	not_revertant	high_impact	snv	decreased_function	23.1	no	.	.
cyp2e1	sg8	.	no_effect	no_effect	intron_variant	rs943975	C	T	135342260	C	not_revertant	133528756	C	not_revertant	low_impact	snv	.	9.833	no	.	.
cyp2e1	sg9	.	no_effect	no_effect	intron_variant	rs1536828	G	C	135342315	G	not_revertant	133528811	G	not_revertant	low_impact	snv	.	0.994	no	.	.
cyp2e1	sg10	.	no_effect	no_effect	intron_variant	rs915906	C	T	135343738	C	not_revertant	133530234	C	not_revertant	low_impact	snv	.	6.177	no	.	.
cyp2e1	sg11	.	no_effect	no_effect	intron_variant	rs2771202	T	C	135344529	T	not_revertant	133531025	T	not_revertant	low_impact	snv	.	0.81	no	.	.
cyp2e1	sg12	4768G>A	V179I	V179I	missense_variant	rs6413419	G	A	135345675	G	not_revertant	133532171	G	not_revertant	low_impact	snv	normal_function	23	no	.	.
cyp2e1	sg13	7632T>A	no_effect	no_effect	intron_variant	.	T	A	135348873	T	not_revertant	133535369	T	not_revertant	low_impact	snv	unknown_function	2.212	no	.	.
cyp2e1	sg14	9896C>G	no_effect	no_effect	intron_variant	rs2070676	C	G	135351137	G	revertant	133537633	G	revertant	low_impact	snv	.	2.815	no	.	.
cyp2e1	sg15	10023G>A	V389I	V389I	missense_variant	rs55897648	G	A	135351264	G	not_revertant	133537760	G	not_revertant	low_impact	snv	normal_function	0.136	no	.	.
cyp2f1	sg1	NG_14_15insC	frameshift	frameshift	frameshift_variant	rs3833221	G	GC	41622107	G	not_revertant	41116202	G	not_revertant	high_impact	indel	no_function	16.18	yes	.	.
cyp2f1	sg2	NG_112T>C	S38P	S38P	missense_variant	rs58285195	T	C	41622205	T	not_revertant	41116300	T	not_revertant	moderate_impact	snv	.	14.24	no	.	.
cyp2f1	sg3	NG_388G>C	R98P	R98P	missense_variant	rs57670668	G	C	41622481	G	not_revertant	41116576	G	not_revertant	moderate_impact	snv	unknown_function	23.2	no	.	.
cyp2f1	sg4	NG_5775G>A	D218N	D218N	missense_variant	rs305974	G	A	41627868	G	not_revertant	41121963	G	not_revertant	moderate_impact	snv	.	12.85	no	.	.
cyp2f1	sg5	NG_5921G>C	Q266H	Q266H	missense_variant	rs75405062	G	C	41628014	G	not_revertant	41122109	G	not_revertant	moderate_impact	snv	.	11.17	no	.	.
cyp2f1	sg6	NG_9324T>C	L391P	L391P	missense_variant	rs144315434	T	C	41631417	T	not_revertant	41125512	T	not_revertant	moderate_impact	snv	unknown_function	23	no	.	.
cyp2f1	sg7	NG_11887C>T	P490L	P490L	missense_variant	rs7246981	C	T	41633980	C	not_revertant	41128075	C	not_revertant	moderate_impact	snv	.	10.08	no	.	.
cyp2j2	sg1	NG_25662A>T	N404Y	N404Y	missense_variant	rs72547598	T	A	60366757	T	not_revertant	59901085	T	not_revertant	moderate_impact	snv	unknown_function	23.9	no	.	.
cyp2j2	sg2	NG_21737C>T	P351L	P351L	missense_variant	rs148429756	G	A	60370682	G	not_revertant	59905010	G	not_revertant	moderate_impact	snv	unknown_function	23.4	no	.	.
cyp2j2	sg3	NG_21709G>A	D342N	D342N	missense_variant	rs56053398	C	T	60370710	C	not_revertant	59905038	C	not_revertant	moderate_impact	snv	unknown_function	25.6	no	.	.
cyp2j2	sg4	NG_18892G>A	G312R	G312R	missense_variant	rs150461093	C	T	60373527	C	not_revertant	59907855	C	not_revertant	high_impact	snv	unknown_function	31	no	.	.
cyp2j2	sg5	NG_15030T>A	I192N	I192N	missense_variant	rs66515830	A	T	60377389	A	not_revertant	59911717	A	not_revertant	moderate_impact	snv	unknown_function	29.4	no	.	.
cyp2j2	sg6	.	V188I	V188I	missense_variant	rs529370939	C	T	60377402	C	not_revertant	59911730	C	not_revertant	moderate_impact	snv	.	24.8	no	.	.
cyp2j2	sg7	NG_14534C>T	R158C	R158C	missense_variant	rs56307989	G	A	60377885	G	not_revertant	59912213	G	not_revertant	moderate_impact	snv	unknown_function	23.5	no	.	.
cyp2j2	sg8	NG_14489A>G	T143A	T143A	missense_variant	rs55753213	T	C	60377930	T	not_revertant	59912258	T	not_revertant	moderate_impact	snv	unknown_function	8.656	no	.	.
cyp2j2	sg9	NG_10780C>T	P115L	P115L	missense_variant	.	G	A	60381639	G	not_revertant	59915967	G	not_revertant	moderate_impact	snv	unknown_function	16	no	.	.
cyp2j2	sg10	.	no_effect	no_effect	intron_variant	rs11572214	C	T	60387600	C	not_revertant	59921928	C	not_revertant	low_impact	snv	.	8.333	no	.	.
cyp2j2	sg11	.	no_effect	no_effect	intron_variant	rs10493270	G	A	60388674	G	not_revertant	59923002	G	not_revertant	low_impact	snv	.	0.348	no	.	.
cyp2j2	sg12	NG_-76G>T	no_effect	no_effect	upstream_gene_variant	rs890293	C	A	60392494	C	not_revertant	59926822	C	not_revertant	low_impact	snv	unknown_function	7.653	no	.	.
cyp2j2	sg13	.	no_effect	no_effect	upstream_gene_variant	rs7533359	T	C	60393416	T	not_revertant	59927744	T	not_revertant	low_impact	snv	.	7.553	no	.	.
cyp2r1	sg1	NG_11359T>C	L99P	L99P	missense_variant	rs61495246	A	G	14907393	A	not_revertant	14885847	A	not_revertant	moderate_impact	snv	unknown_function	29.4	no	.	.
cyp2s1	sg1	.	no_effect	no_effect	upstream_gene_variant	rs10425852	A	G	41697222	A	not_revertant	41191317	A	not_revertant	low_impact	snv	.	5.015	no	.	.
cyp2s1	sg2	.	no_effect	no_effect	intron_variant	rs338600	C	T	41700343	C	not_revertant	41194438	C	not_revertant	low_impact	snv	.	3.534	no	.	.
cyp2s1	sg3	NG_1284G>A	S61N	S61N	missense_variant	rs200051547	G	A	41700453	G	not_revertant	41194548	G	not_revertant	moderate_impact	snv	unknown_function	22.4	no	.	.
cyp2s1	sg4	.	P74#	P74#	synonymous_variant	rs338599	G	C	41700493	G	not_revertant	41194588	C	revertant	low_impact	snv	.	14.03	no	.	.
cyp2s1	sg5	NG_5479T>G	L230R	L230R	missense_variant	rs8192795	T	G	41704648	T	not_revertant	41198743	T	not_revertant	high_impact	snv	unknown_function	24.2	no	.	.
cyp2s1	sg6	.	no_effect	no_effect	intron_variant	rs338592	A	G	41704832	A	not_revertant	41198927	G	revertant	low_impact	snv	.	1.128	no	.	.
cyp2s1	sg7	NG_10347C>T	R380C	R380C	missense_variant	rs72547592	C	T	41709516	C	not_revertant	41203611	C	not_revertant	moderate_impact	snv	unknown_function	8.03	no	.	.
cyp2s1	sg8	NG_13106C>T	P466L	P466L	missense_variant	rs34971233	C	T	41712275	C	not_revertant	41206370	C	not_revertant	moderate_impact	snv	unknown_function	14.87	no	.	.
cyp2w1	sg1	NG_166C>T	L56#	L56#	synonymous_variant	rs2272375	C	T	1023013	C	not_revertant	983377	C	not_revertant	low_impact	snv	.	13.81	no	.	.
cyp2w1	sg2	NG_173A>C	E58A	E58A	missense_variant	rs1316523256	A	C	1023020	A	not_revertant	983384	A	not_revertant	moderate_impact	snv	unknown_function	27.5	no	.	.
cyp2w1	sg3	NG_2008G>A	A181T	A181T	missense_variant	rs3735684	G	A	1024855	G	not_revertant	985219	G	not_revertant	moderate_impact	snv	unknown_function	1.297	no	.	.
cyp2w1	sg4	NG_5432G>A	V432I	V432I	missense_variant	rs78873069	G	A	1028279	G	not_revertant	988643	G	not_revertant	moderate_impact	snv	unknown_function	6.723	no	.	.
cyp2w1	sg5	NG_5584G>C	Q482H	Q482H	missense_variant	rs773499447	G	C	1028431	G	not_revertant	988795	G	not_revertant	moderate_impact	snv	.	13.96	no	.	.
cyp2w1	sg6	NG_5601C>T	P488L	P488L	missense_variant	rs3808348	C	T	1028448	C	not_revertant	988812	C	not_revertant	moderate_impact	snv	unknown_function	16.09	no	.	.
cyp3a4	sg1	25889_25890insA	frameshift	frameshift	frameshift_variant	rs67666821	G	GT	99355806	G	not_revertant	99758183	G	not_revertant	high_impact	indel	no_function	26.1	yes	.	.
cyp3a4	sg2	25721A>G	no_effect	no_effect	intron_variant	rs3735451	T	C	99355975	T	not_revertant	99758352	T	not_revertant	low_impact	snv	.	2.347	no	.	.
cyp3a4	sg3	23237C>T	P467S	P467S	missense_variant	rs4986913	G	A	99358459	G	not_revertant	99760836	G	not_revertant	moderate_impact	snv	unknown_function	12.84	no	.	.
cyp3a4	sg4	23171T>C	M445T	M445T	missense_variant	rs4986910	A	G	99358524	A	not_revertant	99760901	A	not_revertant	moderate_impact	snv	unknown_function	23.9	no	.	.
cyp3a4	sg5	22026C>T	P416L	P416L	missense_variant	rs4986909	G	A	99359670	G	not_revertant	99762047	G	not_revertant	high_impact	snv	decreased_function	24.7	no	.	.
cyp3a4	sg6	21896C>T	L373F	L373F	missense_variant	rs12721629	G	A	99359800	G	not_revertant	99762177	G	not_revertant	high_impact	snv	decreased_function	20.9	no	.	.
cyp3a4	sg7	21867C>T	T363M	T363M	missense_variant	rs67784355	G	A	99359829	G	not_revertant	99762206	G	not_revertant	high_impact	snv	decreased_function	18.4	no	.	.
cyp3a4	sg8	.	no_effect	no_effect	intron_variant	rs2740580	C	G	99360161	C	not_revertant	99762538	C	not_revertant	low_impact	snv	.	0.168	no	.	.
cyp3a4	sg9	20148A>G	Y319C	Y319C	missense_variant	rs201821708	T	C	99361548	T	not_revertant	99763925	T	not_revertant	moderate_impact	snv	unknown_function	25.2	no	.	.
cyp3a4	sg10	.	S311N	S311N	missense_variant	rs766060602	C	T	99361572	C	not_revertant	99763949	C	not_revertant	high_impact	snv	unknown_function	23.7	no	.	.
cyp3a4	sg11	20070T>C	L293P	L293P	missense_variant	rs28371759	A	G	99361626	A	not_revertant	99764003	A	not_revertant	moderate_impact	snv	unknown_function	15.13	no	.	.
cyp3a4	sg12	17661_176622insA	frameshift	frameshift	frameshift_variant	rs4646438	G	GT	99364034	G	not_revertant	99766411	G	not_revertant	high_impact	indel	unknown_function	32	yes	.	.
cyp3a4	sg13	17633C>T	R268X	R268X	stop_gained	rs138105638	G	A	99364063	G	not_revertant	99766440	G	not_revertant	high_impact	snv	no_function	35	yes	.	.
cyp3a4	sg14	.	no_effect	no_effect	intron_variant	rs2687117	A	G	99365451	A	not_revertant	99767828	A	not_revertant	low_impact	snv	.	2.816	no	.	.
cyp3a4	sg15	15753T>G	no_effect	no_effect	intron_variant	rs2687116	A	C	99365943	C	revertant	99768320	C	revertant	low_impact	snv	.	0.006	no	.	.
cyp3a4	sg16	15713T>C	S222P	S222P	missense_variant	rs55785340	A	G	99365983	A	not_revertant	99768360	A	not_revertant	moderate_impact	snv	unknown_function	13.12	no	.	.
cyp3a4	sg17	15702C>G	P218R	P218R	missense_variant	rs55901263	G	C	99365994	G	not_revertant	99768371	G	not_revertant	moderate_impact	snv	unknown_function	23.1	no	.	.
cyp3a4	sg18	15649A>T	Q200H	Q200H	missense_variant	rs113667357	T	A	99366047	T	not_revertant	99768424	T	not_revertant	moderate_impact	snv	.	14.4	no	.	.
cyp3a4	sg19	15615T>C	F189S	F189S	missense_variant	rs4987161	A	G	99366081	A	not_revertant	99768458	A	not_revertant	high_impact	snv	decreased_function	27	no	.	.
cyp3a4	sg20	15603C>G	T185S	T185S	missense_variant	rs12721627	G	C	99366093	G	not_revertant	99768470	G	not_revertant	high_impact	snv	decreased_function	22.7	no	.	.
cyp3a4	sg21	15389C>T	no_effect	no_effect	intron_variant	rs35599367	G	A	99366316	G	not_revertant	99768693	G	not_revertant	high_impact	snv	decreased_function	0.845	no	.	.
cyp3a4	sg22	14304G>C	D174H	D174H	missense_variant	rs4986908	C	G	99367392	C	not_revertant	99769769	C	not_revertant	moderate_impact	snv	unknown_function	17.93	no	.	.
cyp3a4	sg23	14292G>A	V170I	V170I	missense_variant	rs72552798	C	T	99367404	C	not_revertant	99769781	C	not_revertant	moderate_impact	snv	unknown_function	0.458	no	.	.
cyp3a4	sg24	14269G>A	R162Q	R162Q	missense_variant	rs4986907	C	T	99367427	C	not_revertant	99769804	C	not_revertant	moderate_impact	snv	unknown_function	1.225	no	.	.
cyp3a4	sg25	14268C>T	R162W	R162W	missense_variant	rs57409622	G	A	99367428	G	not_revertant	99769805	G	not_revertant	moderate_impact	snv	.	21	no	.	.
cyp3a4	sg26	13908G>A	R130Q	R130Q	missense_variant	rs72552799	C	T	99367788	C	not_revertant	99770165	C	not_revertant	high_impact	snv	decreased_function	22.3	no	.	.
cyp3a4	sg27	13871A>G	I118V	I118V	missense_variant	rs55951658	T	C	99367825	T	not_revertant	99770202	T	not_revertant	moderate_impact	snv	unknown_function	13.89	no	.	.
cyp3a4	sg28	.	no_effect	no_effect	intron_variant	rs2738258	T	C	99370493	T	not_revertant	99772870	T	not_revertant	low_impact	snv	.	0.021	no	.	.
cyp3a4	sg29	.	no_effect	no_effect	intron_variant	rs2687110	A	T	99370751	A	not_revertant	99773128	A	not_revertant	low_impact	snv	.	0.724	no	.	.
cyp3a4	sg30	.	no_effect	no_effect	intron_variant	rs2687107	A	T	99372041	A	not_revertant	99774418	A	not_revertant	low_impact	snv	.	1.951	no	.	.
cyp3a4	sg31	.	no_effect	no_effect	intron_variant	rs2738262	G	A	99372130	G	not_revertant	99774507	G	not_revertant	low_impact	snv	.	9.775	no	.	.
cyp3a4	sg32	.	no_effect	no_effect	intron_variant	rs2404767	G	A	99372557	G	not_revertant	99774934	G	not_revertant	low_impact	snv	.	2.841	no	.	.
cyp3a4	sg33	.	no_effect	no_effect	intron_variant	rs4281055	G	A	99373649	G	not_revertant	99776026	G	not_revertant	low_impact	snv	.	12.67	no	.	.
cyp3a4	sg34	6004G>A	G56D	G56D	missense_variant	rs56324128	C	T	99375702	C	not_revertant	99778079	C	not_revertant	moderate_impact	snv	unknown_function	25.7	no	.	.
cyp3a4	sg35	.	no_effect	no_effect	intron_variant	rs2687105	A	T	99376946	A	not_revertant	99779323	A	not_revertant	low_impact	snv	.	5.289	no	.	.
cyp3a4	sg36	44T>C	L15P	L15P	missense_variant	rs12721634	A	G	99381661	A	not_revertant	99784038	A	not_revertant	moderate_impact	snv	unknown_function	22.8	no	.	.
cyp3a4	sg37	-392A>G	no_effect	no_effect	upstream_gene_variant	rs2740574	T	C	99382096	C	revertant	99784473	C	revertant	low_impact	snv	unknown_function	5.538	no	.	.
cyp3a5	sg1	27289C>A	T398N	T398N	missense_variant	rs28365083	G	T	99250236	G	not_revertant	99652613	G	not_revertant	moderate_impact	snv	unknown_function	2.123	no	.	.
cyp3a5	sg2	27131_27132insT	frameshift	frameshift	frameshift_variant	rs41303343	T	TA	99250393	T	not_revertant	99652770	T	not_revertant	high_impact	indel	no_function	23.5	yes	.	.
cyp3a5	sg3	19386G>A	A337T	A337T	missense_variant	rs28383479	C	T	99258139	C	not_revertant	99660516	C	not_revertant	moderate_impact	snv	unknown_function	12.48	no	.	.
cyp3a5	sg4	14690G>A	K208#&splicing_defect	K208#&splicing_defect	synonymous_variant	rs10264272	C	T	99262835	C	not_revertant	99665212	C	not_revertant	high_impact	snv	no_function	3.311	yes	.	.
cyp3a5	sg5	14665A>G	Q200R	Q200R	missense_variant	rs56411402	T	C	99262860	T	not_revertant	99665237	T	not_revertant	moderate_impact	snv	unknown_function	16.34	no	.	.
cyp3a5	sg6	12952T>C	splicing_defect	splicing_defect	splice_donor_variant	rs55965422	A	G	99264573	A	not_revertant	99666950	A	not_revertant	high_impact	snv	unknown_function	27.8	yes	.	.
cyp3a5	sg7	6986A>G 	splicing_defect	splicing_defect	splice_acceptor_variant	rs776746	T	C	99270539	C	revertant	99672916	T	not_revertant	high_impact	snv	no_function	3.863	yes	.	.
cyp3a5	sg8	3699C>T	R28C	R28C	missense_variant	rs55817950	G	A	99273821	G	not_revertant	99676198	G	not_revertant	moderate_impact	snv	unknown_function	11.04	no	.	.
cyp3a7	sg1	NG_26032C>G	T409R	T409R	missense_variant	rs2257401	G	C	99306685	C	revertant	99709062	G	not_revertant	moderate_impact	snv	unknown_function	13.94	no	.	.
cyp3a7	sg2	NG_4011_4012insT	frameshift	frameshift	frameshift_variant	.	C	CA	99328705	C	not_revertant	99731082	C	not_revertant	high_impact	indel	no_function	16.12	yes	.	.
cyp3a7	sg3	NG_-49G>A	no_effect	no_effect	upstream_gene_variant	rs28451617	C	T	99332765	C	not_revertant	99735142	C	not_revertant	low_impact	snv	unknown_function	0.15	no	.	.
cyp3a7	sg4	NG_-91G>A	no_effect	no_effect	upstream_gene_variant	rs55798860	C	T	99332807	C	not_revertant	99735184	C	not_revertant	low_impact	snv	unknown_function	1.07	no	.	.
cyp3a7	sg5	NG_-232A>C	no_effect	no_effect	upstream_gene_variant	rs45446698	T	G	99332948	T	not_revertant	99735325	T	not_revertant	low_impact	snv	.	1.483	no	.	.
cyp3a7	sg6	NG_-262T>A	no_effect	no_effect	upstream_gene_variant	rs11568826	A	T	99332978	A	not_revertant	99735355	A	not_revertant	low_impact	snv	.	0.552	no	.	.
cyp3a7	sg7	NG_-270T>G	no_effect	no_effect	upstream_gene_variant	rs11568825	A	C	99332986	A	not_revertant	99735363	A	not_revertant	low_impact	snv	.	1.161	no	.	.
cyp3a7	sg8	NG_-281A>T	no_effect	no_effect	upstream_gene_variant	rs45467892	T	A	99332997	T	not_revertant	99735374	T	not_revertant	low_impact	snv	.	0.09	no	.	.
cyp3a7	sg9	NG_-282T>C	no_effect	no_effect	upstream_gene_variant	rs45575938	A	G	99332998	A	not_revertant	99735375	A	not_revertant	low_impact	snv	.	0.373	no	.	.
cyp3a7	sg10	NG_-284T>A	no_effect	no_effect	upstream_gene_variant	rs45494802	A	T	99333000	A	not_revertant	99735377	A	not_revertant	low_impact	snv	.	0.522	no	.	.
cyp3a7	sg11	NG_-291G>T	no_effect	no_effect	upstream_gene_variant	rs11568824	C	A	99333007	C	not_revertant	99735384	C	not_revertant	low_impact	snv	.	0.042	no	.	.
cyp3a7	sg12	NG_-314C>T	no_effect	no_effect	upstream_gene_variant	rs45465393	G	A	99333030	G	not_revertant	99735407	G	not_revertant	low_impact	snv	unknown_function	0.787	no	.	.
cyp3a43	sg1	NG_8340delA	frameshift	frameshift	frameshift_variant	rs61469810	TA	T	99434077	TA	not_revertant	99836454	TA	not_revertant	high_impact	indel	no_function	22.5	yes	.	.
cyp3a43	sg2	.	L249X	L249X	stop_gained	rs759645964	T	A	99453289	T	not_revertant	99855666	T	not_revertant	high_impact	snv	unknown_function	35	yes	.	.
cyp3a43	sg3	NG_31867C>G	P340A	P340A	missense_variant	rs680055	C	G	99457605	C	not_revertant	99859982	C	not_revertant	moderate_impact	snv	unknown_function	17.03	no	.	.
cyp3a43	sg4	NG_33518C>T	A349#	A349#	synonymous_variant	rs17342647	C	T	99459256	C	not_revertant	99861633	C	not_revertant	low_impact	snv	unknown_function	2.823	no	.	.
cyp4a11	sg1	8610T>C	F434S	F434S	missense_variant	rs1126742	A	G	47398496	A	not_revertant	46932824	A	not_revertant	high_impact	snv	decreased_function	14.47	no	.	.
cyp4a11	sg2	7227A>G	S353G	S353G	missense_variant	rs3899049	T	C	47399879	T	not_revertant	46934207	T	not_revertant	moderate_impact	snv	unknown_function	11.4	no	.	.
cyp4a22	sg1	31C>T	R11C	R11C	missense_variant	rs76011927	C	T	47603188	C	not_revertant	47137516	C	not_revertant	moderate_impact	snv	.	10.62	no	.	.
cyp4a22	sg2	4124C>T	R126W	R126W	missense_variant	rs12564525	C	T	47607281	C	not_revertant	47141609	C	not_revertant	moderate_impact	snv	.	15.47	no	.	.
cyp4a22	sg3	4628G>A	G130S	G130S	missense_variant	rs2056900	G	A	47607785	G	not_revertant	47142113	G	not_revertant	moderate_impact	snv	.	22.4	no	.	.
cyp4a22	sg4	4694A>T	N152Y	N152Y	missense_variant	rs2056899	A	T	47607851	A	not_revertant	47142179	A	not_revertant	moderate_impact	snv	.	13.8	no	.	.
cyp4a22	sg5	5826G>T	V185F	V185F	missense_variant	rs4926581	G	T	47608983	G	not_revertant	47143311	G	not_revertant	moderate_impact	snv	.	16.05	no	.	.
cyp4a22	sg6	6332T>C	C231R	C231R	missense_variant	rs10789501	T	C	47609489	T	not_revertant	47143817	T	not_revertant	moderate_impact	snv	.	5.975	no	.	.
cyp4a22	sg7	6908A>C	K276T	K276T	missense_variant	rs6661132	A	C	47610065	A	not_revertant	47144393	A	not_revertant	moderate_impact	snv	.	21.8	no	.	.
cyp4a22	sg8	7067delG	frameshift	frameshift	frameshift_variant	rs201802480	TG	T	47610223	TG	not_revertant	47144551	TG	not_revertant	high_impact	indel	unknown_function	25.1	yes	.	.
cyp4a22	sg9	7136C>T	H323#	H323#	synonymous_variant	rs968322	C	T	47610293	C	not_revertant	47144621	C	not_revertant	low_impact	snv	.	7.427	no	.	.
cyp4a22	sg10	7365C>T	Q368X	Q368X	stop_gained	rs570554271	C	T	47610522	C	not_revertant	47144850	C	not_revertant	high_impact	snv	.	37	yes	.	.
cyp4a22	sg11	7433A>C	G390#	G390#	synonymous_variant	rs2405593	A	C	47610590	A	not_revertant	47144918	A	not_revertant	low_impact	snv	.	6.431	no	.	.
cyp4a22	sg12	8441T>C	L428P	L428P	missense_variant	rs2405599	T	C	47611598	T	not_revertant	47145926	T	not_revertant	moderate_impact	snv	.	12.83	no	.	.
cyp4a22	sg13	11277C>T	L509F	L509F	missense_variant	rs4926600	C	T	47614434	C	not_revertant	47148762	C	not_revertant	moderate_impact	snv	.	18.13	no	.	.
cyp4b1	sg1	.	no_effect	no_effect	intron_variant	rs837402	T	C	47265665	T	not_revertant	46799993	T	not_revertant	low_impact	snv	.	5.403	no	.	.
cyp4b1	sg2	.	no_effect	no_effect	intron_variant	rs837401	C	T	47265677	C	not_revertant	46800005	C	not_revertant	low_impact	snv	.	2.761	no	.	.
cyp4b1	sg3	.	no_effect	no_effect	intron_variant	rs837400	A	G	47265776	A	not_revertant	46800104	A	not_revertant	low_impact	snv	.	7.783	no	.	.
cyp4b1	sg4	.	no_effect	no_effect	intron_variant	rs837399	C	T	47266151	C	not_revertant	46800479	C	not_revertant	low_impact	snv	.	0.345	no	.	.
cyp4b1	sg5	517C>T	R173W	R173W	missense_variant	rs4646487	C	T	47279175	C	not_revertant	46813503	C	not_revertant	moderate_impact	snv	unknown_function	22.5	no	.	.
cyp4b1	sg6	.	H282Q	H282Q	missense_variant	rs45463299	C	A	47279954	C	not_revertant	46814282	C	not_revertant	moderate_impact	snv	.	24.2	no	.	.
cyp4b1	sg7	881_882delAT	frameshift	frameshift	frameshift_variant	rs3215983	GAT	G	47280746	GAT	not_revertant	46815074	GAT	not_revertant	high_impact	indel	unknown_function	27.8	yes	.	.
cyp4b1	sg8	964A>G	S322G	S322G	missense_variant	rs45467195	A	G	47280830	A	not_revertant	46815158	A	not_revertant	moderate_impact	snv	unknown_function	23.3	no	.	.
cyp4b1	sg9	993G>A	M331I	M331I	missense_variant	rs2297810	G	A	47280859	G	not_revertant	46815187	G	not_revertant	high_impact	snv	unknown_function	22.9	no	.	.
cyp4b1	sg10	1018C>T	R340C	R340C	missense_variant	rs4646491	C	T	47280884	C	not_revertant	46815212	C	not_revertant	moderate_impact	snv	.	15.64	no	.	.
cyp4b1	sg11	1033G>A	V345I	V345I	missense_variant	.	G	A	47280899	G	not_revertant	46815227	G	not_revertant	moderate_impact	snv	.	0.098	no	.	.
cyp4b1	sg12	.	R375C	R375C	missense_variant	rs2297809	C	T	47282772	C	not_revertant	46817100	C	not_revertant	high_impact	snv	.	34	no	.	Despite being a missense variant with high CADD score, this variant is not used to define a star allele because it is in LD with CYP4B*2 (47280746:GAT>G), which is already predicted to be non-functional.
cyp4f2	sg1	.	A483G	A483G	missense_variant	rs3952537	G	C	15989696	G	not_revertant	15878886	G	not_revertant	moderate_impact	snv	.	20.6	no	.	.
cyp4f2	sg2	.	T472A	T472A	missense_variant	rs4020346	T	C	15989730	T	not_revertant	15878920	T	not_revertant	moderate_impact	snv	.	11.4	no	.	.
cyp4f2	sg3	NG_17991G>A	V433M	V433M	missense_variant	rs2108622	C	T	15990431	C	not_revertant	15879621	C	not_revertant	high_impact	snv	decreased_function	24	no	.	.
cyp4f2	sg4	.	G310R	G310R	missense_variant	rs754533672	C	T	15997109	C	not_revertant	15886299	C	not_revertant	moderate_impact	snv	.	23.6	no	.	.
cyp4f2	sg5	.	no_effect	no_effect	intron_variant	rs778301935	T	C	16001119	T	not_revertant	15890309	T	not_revertant	low_impact	snv	.	13.67	no	.	.
cyp4f2	sg6	.	R47C	R47C	missense_variant	rs115517770	G	A	16008283	G	not_revertant	15897473	G	not_revertant	moderate_impact	snv	.	16.4	no	.	.
cyp4f2	sg7	.	A27V	A27V	missense_variant	rs771576634	G	A	16008342	G	not_revertant	15897532	G	not_revertant	moderate_impact	snv	.	9.77	no	.	.
cyp4f2	sg8	NG_34T>G	W12G	W12G	missense_variant	rs3093105	A	C	16008388	A	not_revertant	15897578	A	not_revertant	moderate_impact	snv	normal_function	3.116	no	.	.
cyp17a1	sg1	.	R496H	R496H	missense_variant	rs763398879	C	T	104590499	C	not_revertant	102830742	C	not_revertant	high_impact	snv	severely_decreased_function	31	no	.	.
cyp17a1	sg2	.	R496C	R496C	missense_variant	rs1250463562	G	A	104590500	G	not_revertant	102830743	G	not_revertant	high_impact	snv	severely_decreased_function	28.7	no	.	.
cyp17a1	sg3	.	D487_F489del	D487_F489del	inframe_deletion	rs756135168	TGAAAGAGTC	T	104590518	TGAAAGAGTC	not_revertant	102830761	TGAAAGAGTC	not_revertant	high_impact	indel	no_function	21.8	no	.	.
cyp17a1	sg4	.	L465P	L465P	missense_variant	.	A	G	104590592	A	not_revertant	102730530	A	not_revertant	high_impact	snv	severely_decreased_function	31	no	.	.
cyp17a1	sg5	.	F453S	F453S	missense_variant	rs104894151	A	G	104590628	A	not_revertant	102830871	A	not_revertant	high_impact	snv	severely_decreased_function	32	no	.	.
cyp17a1	sg6	.	R440H	R440H	missense_variant	rs777638364	C	T	104590667	C	not_revertant	102830910	C	not_revertant	high_impact	snv	no_function	33	no	.	.
cyp17a1	sg7	.	R440C	R440C	missense_variant	rs868228603	G	A	104590668	G	not_revertant	102830911	G	not_revertant	high_impact	snv	no_function	33	no	.	.
cyp17a1	sg8	.	P434L	P434L	missense_variant	.	G	A	104590685	G	not_revertant	102830928	G	not_revertant	high_impact	snv	severely_decreased_function	29.9	no	.	.
cyp17a1	sg9	.	P428L	P428L	missense_variant	rs104894145	G	A	104590703	G	not_revertant	102830946	G	not_revertant	high_impact	snv	severely_decreased_function	25.4	no	.	.
cyp17a1	sg10	.	F417C	F417C	missense_variant	rs104894140	A	C	104590736	A	not_revertant	102830979	A	not_revertant	high_impact	snv	no_function	26.5	no	.	.
cyp17a1	sg11	.	R416H	R416H	missense_variant	rs104894155	C	T	104590739	C	not_revertant	102830982	C	not_revertant	high_impact	snv	no_function	25.3	no	.	.
cyp17a1	sg12	.	R416C	R416C	missense_variant	rs1178684770	G	A	104590740	G	not_revertant	102830983	G	not_revertant	high_impact	snv	severely_decreased_function	25.8	no	.	.
cyp17a1	sg13	.	P409R	P409R	missense_variant	rs367833709	G	C	104591282	G	not_revertant	102831525	G	not_revertant	high_impact	snv	no_function	25	no	.	.
cyp17a1	sg14	.	W406R	W406R	missense_variant	rs104894143	A	G	104591292	A	not_revertant	102831535	A	not_revertant	high_impact	snv	no_function	24.1	no	.	.
cyp17a1	sg15	.	H373L	H373L	missense_variant	rs760695410	T	A	104592289	T	not_revertant	102832532	T	not_revertant	high_impact	snv	no_function	27.6	no	.	.
cyp17a1	sg16	.	H373D	H373D	missense_variant	rs1423560123	G	C	104592290	G	not_revertant	102832533	G	not_revertant	high_impact	snv	no_function	28.2	no	.	.
cyp17a1	sg17	.	H373N	H373N	missense_variant	rs1423560123	G	T	104592290	G	not_revertant	102832533	G	not_revertant	high_impact	snv	no_function	27.6	no	.	.
cyp17a1	sg18	.	R362H	R362H	missense_variant	rs752811843	C	T	104592322	C	not_revertant	102832565	C	not_revertant	high_impact	snv	no_function	33	no	.	.
cyp17a1	sg19	.	R362C	R362C	missense_variant	rs104894142	G	A	104592323	G	not_revertant	102832566	G	not_revertant	high_impact	snv	no_function	33	no	.	.
cyp17a1	sg20	.	R358Q	R358Q	missense_variant	rs104894139	C	T	104592334	C	not_revertant	102832577	C	not_revertant	high_impact	snv	decreased_function	31	no	.	.
cyp17a1	sg21	.	A355T	A355T	missense_variant	rs751960113	C	T	104592344	C	not_revertant	102832587	C	not_revertant	high_impact	snv	no_function	27.2	no	.	.
cyp17a1	sg22	.	L351del	L351del	inframe_deletion	.	GGAG	G	104592353	GGAG	not_revertant	102832596	GGAG	not_revertant	high_impact	indel	no_function	14.4	no	.	.
cyp17a1	sg23	.	R347H	R347H	missense_variant	rs61754278	C	T	104592367	C	not_revertant	102832610	C	not_revertant	high_impact	snv	decreased_function	24.6	no	.	.
cyp17a1	sg24	.	R347C	R347C	missense_variant	rs104894149	G	A	104592368	G	not_revertant	102832611	G	not_revertant	high_impact	snv	severely_decreased_function	24	no	.	.
cyp17a1	sg25	.	P342T	P342T	missense_variant	rs104894137	G	T	104592383	G	not_revertant	102832626	G	not_revertant	high_impact	snv	decreased_function	24.4	no	.	.
cyp17a1	sg26	.	I332T	I332T	missense_variant	rs772804570	A	G	104592412	A	not_revertant	102832655	A	not_revertant	high_impact	snv	severely_decreased_function	25.3	no	.	.
cyp17a1	sg27	.	E331del	E331del	inframe_deletion	rs759060233	TCTC	T	104592413	TCTC	not_revertant	102832656	TCTC	not_revertant	high_impact	indel	no_function	20.1	no	.	.
cyp17a1	sg28	.	Y329D	Y329D	missense_variant	rs104894144	A	C	104592422	A	not_revertant	102832665	A	not_revertant	high_impact	snv	severely_decreased_function	22.8	no	.	.
cyp17a1	sg29	.	E305G	E305G	missense_variant	.	T	C	104592805	T	not_revertant	102833048	T	not_revertant	high_impact	snv	decreased_function	26.9	no	.	.
cyp17a1	sg30	.	Y201N	Y201N	missense_variant	.	A	T	104594607	A	not_revertant	102834850	A	not_revertant	high_impact	snv	severely_decreased_function	21.4	no	.	.
cyp17a1	sg31	.	V178D	V178D	missense_variant	rs1234392302	A	T	104594675	A	not_revertant	102834918	A	not_revertant	high_impact	snv	no_function	24.1	no	.	.
cyp17a1	sg32	.	N177D	N177D	missense_variant	.	T	C	104594679	T	not_revertant	102834922	T	not_revertant	high_impact	snv	severely_decreased_function	24.5	no	.	.
cyp17a1	sg33	.	A174E	A174E	missense_variant	rs752540777	G	T	104594687	G	not_revertant	102834930	G	not_revertant	high_impact	snv	severely_decreased_function	21.3	no	.	.
cyp17a1	sg34	.	R125Q	R125Q	missense_variant	rs104894154	C	T	104595073	C	not_revertant	102835316	C	not_revertant	high_impact	snv	no_function	25.3	no	.	.
cyp17a1	sg35	.	D116V 	D116V 	missense_variant	rs104894148	T	A	104595100	T	not_revertant	102835343	T	not_revertant	high_impact	snv	severely_decreased_function	23.3	no	.	.
cyp17a1	sg36	.	F114V	F114V	missense_variant	rs104894147	A	C	104595107	A	not_revertant	102835350	A	not_revertant	high_impact	snv	severely_decreased_function	24.1	no	.	.
cyp17a1	sg37	.	111_112insI	111_112insI	inframe_insertion	.	C	CGAT	104595110	C	not_revertant	102835353	C	not_revertant	high_impact	indel	no_function	14.93	no	.	.
cyp17a1	sg38	.	G111S	G111S	missense_variant	.	C	T	104595116	C	not_revertant	102835359	C	not_revertant	high_impact	snv	no_function	23.5	no	.	.
cyp17a1	sg39	.	S106A	S106A	missense_variant	rs104894135	A	C	104595131	A	not_revertant	102835374	A	not_revertant	high_impact	snv	decreased_function	23.6	no	.	.
cyp17a1	sg40	.	S106P	S106P	missense_variant	rs104894135	A	G	104595131	A	not_revertant	102835374	A	not_revertant	high_impact	snv	no_function	24.2	no	.	.
cyp17a1	sg41	.	S106T	S106T	missense_variant	rs104894135	A	T	104595131	A	not_revertant	102835374	A	not_revertant	high_impact	snv	decreased_function	16.25	no	.	.
cyp17a1	sg42	.	R96W	R96W	missense_variant	rs104894138	G	A	104596833	G	not_revertant	102837076	G	not_revertant	high_impact	snv	no_function	24.7	no	.	.
cyp17a1	sg43	.	F93C	F93C	missense_variant	rs104894146	A	C	104596841	A	not_revertant	102837084	A	not_revertant	high_impact	snv	severely_decreased_function	28	no	.	.
cyp17a1	sg44	.	G90D	G90D	missense_variant	rs778389140	C	T	104596850	C	not_revertant	102837093	C	not_revertant	high_impact	snv	no_function	26.2	no	.	.
cyp17a1	sg45	.	Y64S	Y64S	missense_variant	rs1183147390	T	G	104596928	T	not_revertant	102837171	T	not_revertant	high_impact	snv	decreased_function	23	no	.	.
cyp17a1	sg46	.	F54del	F54del	inframe_deletion	rs121434319	TGAA	T	104596956	TGAA	not_revertant	102837199	TGAA	not_revertant	high_impact	indel	decreased_function	15.1	no	.	.
cyp17a1	sg47	.	P35L 	P35L 	missense_variant	.	G	A	104597015	G	not_revertant	102837258	G	not_revertant	high_impact	snv	decreased_function	26.2	no	.	.
cyp19a1	sg1	30421T>C	M364T	M364T	missense_variant	rs56658716	A	G	51504689	A	not_revertant	51212492	A	not_revertant	high_impact	snv	decreased_function	26.8	no	.	.
cyp19a1	sg2	27142C>T	R264C	R264C	missense_variant	rs700519	G	A	51507968	G	not_revertant	51215771	G	not_revertant	high_impact	snv	decreased_function	23.3	no	.	.
cyp19a1	sg3	20538C>T	T201M	T201M	missense_variant	rs28757184	G	A	51514572	G	not_revertant	51222375	G	not_revertant	moderate_impact	snv	unknown_function	9.077	no	.	.
cyp19a1	sg4	115T>C	W39R	W39R	missense_variant	rs2236722	A	G	51534995	A	not_revertant	51242798	A	not_revertant	high_impact	snv	decreased_function	23.4	no	.	.
cyp26a1	sg1	.	R90P	R90P	missense_variant	rs762599485	G	C	94834144	G	not_revertant	93074387	G	not_revertant	high_impact	snv	unknown_function	32	no	.	.
cyp26a1	sg2	NG_947C>A	R173S	R173S	missense_variant	rs61735552	C	A	94834638	C	not_revertant	93074881	C	not_revertant	moderate_impact	snv	unknown_function	19.79	no	.	.
cyp26a1	sg3	NG_988C>A	F186L	F186L	missense_variant	rs1376885914	C	A	94834679	C	not_revertant	93074922	C	not_revertant	moderate_impact	snv	unknown_function	25.5	no	.	.
cyp26a1	sg4	NG_2682T>C	C358R	C358R	missense_variant	rs146619916	T	C	94836373	T	not_revertant	93076616	T	not_revertant	moderate_impact	snv	unknown_function	24.9	no	.	.
dpyd	sg1	3067C>A	P1023T	P1023T	missense_variant	rs114096998	G	T	97544543	G	not_revertant	97078987	G	not_revertant	low_impact	snv	normal_function	18.81	no	.	.
dpyd	sg2	3061G>C	V1021L	V1021L	missense_variant	rs148799944	C	G	97544549	C	not_revertant	97078993	C	not_revertant	low_impact	snv	normal_function	17.56	no	.	.
dpyd	sg3	3049G>A	V1017I	V1017I	missense_variant	rs140114515	C	T	97544561	C	not_revertant	97079005	C	not_revertant	low_impact	snv	normal_function	13.5	no	.	.
dpyd	sg4	2983G>T	V995F	V995F	missense_variant	rs1801268	C	A	97544627	C	not_revertant	97079071	C	not_revertant	high_impact	snv	no_function	32	no	.	.
dpyd	sg5	2978T>G	L993R	L993R	missense_variant	rs139459586	A	C	97544632	A	not_revertant	97079076	A	not_revertant	low_impact	snv	normal_function	26	no	.	.
dpyd	sg6	2977C>T	L993F	L993F	missense_variant	rs202144771	G	A	97544633	G	not_revertant	97079077	G	not_revertant	low_impact	snv	normal_function	21.8	no	.	.
dpyd	sg7	2933A>G	H978R	H978R	missense_variant	rs72547601	T	C	97544677	T	not_revertant	97079121	T	not_revertant	high_impact	snv	no_function	24.6	no	.	.
dpyd	sg8	2921A>T	D974V	D974V	missense_variant	rs72547602	T	A	97544689	T	not_revertant	97079133	T	not_revertant	low_impact	snv	normal_function	29.2	no	.	.
dpyd	sg9	2915A>G	Q972R	Q972R	missense_variant	rs145529148	T	C	97544695	T	not_revertant	97079139	T	not_revertant	low_impact	snv	normal_function	16.33	no	.	.
dpyd	sg10	2872A>G	K958E	K958E	missense_variant	rs141044036	T	C	97547921	T	not_revertant	97082365	T	not_revertant	high_impact	snv	no_function	29.8	no	.	.
dpyd	sg11	2846A>T	D949V	D949V	missense_variant	rs67376798	T	A	97547947	T	not_revertant	97082391	T	not_revertant	high_impact	snv	decreased_function	25.2	no	.	.
dpyd	sg12	2657G>A	R886H	R886H	missense_variant	rs1801267	C	T	97564154	C	not_revertant	97098598	C	not_revertant	low_impact	snv	.	27.6	no	.	.
dpyd	sg13	2656C>T	R886C	R886C	missense_variant	rs147545709	G	A	97564155	G	not_revertant	97098599	G	not_revertant	high_impact	snv	normal_function	32	no	.	.
dpyd	sg14	2639G>T	G880V	G880V	missense_variant	rs55674432	C	A	97564172	C	not_revertant	97098616	C	not_revertant	high_impact	snv	no_function	26.2	no	.	.
dpyd	sg15	2623A>C	K875Q	K875Q	missense_variant	rs201035051	T	G	97564188	T	not_revertant	97098632	T	not_revertant	low_impact	snv	normal_function	24.6	no	.	.
dpyd	sg16	2582A>G	K861R	K861R	missense_variant	rs60139309	T	C	97658665	T	not_revertant	97193109	T	not_revertant	low_impact	snv	normal_function	24.9	no	.	.
dpyd	sg17	2482G>A	E828K	E828K	missense_variant	rs200687447	C	T	97658765	C	not_revertant	97193209	C	not_revertant	low_impact	snv	normal_function	21	no	.	.
dpyd	sg18	2336C>A	T779N	T779N	missense_variant	rs199634007	G	T	97700514	G	not_revertant	97234958	G	not_revertant	low_impact	snv	normal_function	23.5	no	.	.
dpyd	sg19	2303C>A	T768K	T768K	missense_variant	rs56005131	G	T	97700547	G	not_revertant	97234991	G	not_revertant	low_impact	snv	normal_function	22.9	no	.	.
dpyd	sg20	2279C>T	T760I	T760I	missense_variant	rs112766203	G	A	97770835	G	not_revertant	97305279	G	not_revertant	high_impact	snv	decreased_function	25.6	no	.	.
dpyd	sg21	2195T>G	V732G	V732G	missense_variant	rs60511679	A	C	97770919	A	not_revertant	97305363	A	not_revertant	low_impact	snv	normal_function	27.4	no	.	.
dpyd	sg22	2194G>A	V732I	V732I	missense_variant	rs1801160	C	T	97770920	C	not_revertant	97305364	C	not_revertant	low_impact	snv	normal_function	24.5	no	.	Despite its high CADD score, the variant does not impact enzymatic activity according to CPIC.
dpyd	sg23	2186C>T	A729V	A729V	missense_variant	rs146529561	G	A	97770928	G	not_revertant	97305372	G	not_revertant	low_impact	snv	normal_function	26.5	no	.	.
dpyd	sg24	2161G>A	A721T	A721T	missense_variant	rs145548112	C	T	97771751	C	not_revertant	97306195	C	not_revertant	high_impact	snv	normal_function	32	no	.	.
dpyd	sg25	2021G>A	G674D	G674D	missense_variant	rs137999090	C	T	97839154	C	not_revertant	97373598	C	not_revertant	high_impact	snv	no_function	31	no	.	.
dpyd	sg26	1990G>T	A664S	A664S	missense_variant	rs138545885	C	A	97839185	C	not_revertant	97373629	C	not_revertant	high_impact	snv	normal_function	31	no	.	.
dpyd	sg27	1906A>C	I636L	I636L	missense_variant	rs55971861	T	G	97848017	T	not_revertant	97382461	T	not_revertant	low_impact	snv	normal_function	21.6	no	.	.
dpyd	sg28	1905+1G>A	splicing_defect	splicing_defect	splice_donor_variant	rs3918290 	C	T	97915614	C	not_revertant	97450058	C	not_revertant	high_impact	snv	no_function	31	yes	.	.
dpyd	sg29	1905C>G	N635K	N635K	missense_variant	rs3918289	G	C	97915615	G	not_revertant	97450059	G	not_revertant	low_impact	snv	normal_function	3.897	no	.	.
dpyd	sg30	1898delC	frameshift	frameshift	frameshift_variant	rs72549303	TG	T	97915621	TG	not_revertant	97450065	TG	not_revertant	high_impact	indel	no_function	35	yes	.	.
dpyd	sg31	1896T>C	F632#	F632#	synonymous_variant	rs17376848	A	G	97915624	A	not_revertant	97450068	A	not_revertant	low_impact	snv	normal_function	4.581	no	.	.
dpyd	sg32	1845G>T	E615D	E615D	missense_variant	.	C	A	97915675	C	not_revertant	97450117	C	not_revertant	moderate_impact	snv	unknown_function	19.56	no	.	.
dpyd	sg33	1796T>C	M599T	M599T	missense_variant	rs147601618	A	G	97915724	A	not_revertant	97450168	A	not_revertant	low_impact	snv	normal_function	19.01	no	.	.
dpyd	sg34	1777G>A	G593R	G593R	missense_variant	rs145773863	C	T	97915743	C	not_revertant	97450187	C	not_revertant	high_impact	snv	no_function	26.5	no	.	.
dpyd	sg35	1775G>A	R592Q	R592Q	missense_variant	rs138616379	C	T	97915745	C	not_revertant	97450189	C	not_revertant	high_impact	snv	no_function	32	no	.	.
dpyd	sg36	1774C>T	R592W	R592W	missense_variant	rs59086055	G	A	97915746	G	not_revertant	97450190	G	not_revertant	high_impact	snv	no_function	33	no	.	.
dpyd	sg37	1740+40A>G	no_effect	no_effect	intron_variant	rs2811178	T	C	97981242	T	not_revertant	97515686	T	not_revertant	low_impact	snv	normal_function	2.379	no	.	.
dpyd	sg38	1740+39C>T	no_effect	no_effect	intron_variant	rs2786783	G	A	97981243	G	not_revertant	97515687	G	not_revertant	low_impact	snv	normal_function	2.976	no	.	.
dpyd	sg39	1682G>T	R561L	R561L	missense_variant	rs201615754	C	A	97981340	C	not_revertant	97515784	C	not_revertant	high_impact	snv	normal_function	32	no	.	.
dpyd	sg40	1679T>G	I560S	I560S	missense_variant	rs55886062	A	C	97981343	A	not_revertant	97515787	A	not_revertant	high_impact	snv	no_function	28.7	no	.	.
dpyd	sg41	1627A>G	I543V	I543V	missense_variant	rs1801159	T	C	97981395	T	not_revertant	97515839	T	not_revertant	low_impact	snv	normal_function	15.53	no	.	.
dpyd	sg42	1615G>A	G539R	G539R	missense_variant	rs142619737	C	T	97981407	C	not_revertant	97515851	C	not_revertant	low_impact	snv	normal_function	23.2	no	.	.
dpyd	sg43	1601G>A	S534N	S534N	missense_variant	rs1801158 	C	T	97981421	C	not_revertant	97515865	C	not_revertant	low_impact	snv	normal_function	23	no	.	.
dpyd	sg44	1577C>G	T526S	T526S	missense_variant	rs190951787	G	C	97981445	G	not_revertant	97515889	G	not_revertant	low_impact	snv	normal_function	22.4	no	.	.
dpyd	sg45	1543G>A	V515I	V515I	missense_variant	rs148994843	C	T	97981479	C	not_revertant	97515923	C	not_revertant	low_impact	snv	normal_function	8.466	no	.	.
dpyd	sg46	1519G>A	V507I	V507I	missense_variant	rs138391898	C	T	98015121	C	not_revertant	97549565	C	not_revertant	low_impact	snv	normal_function	7.217	no	.	.
dpyd	sg47	1484A>G	D495G	D495G	missense_variant	rs111858276	T	C	98015156	T	not_revertant	97549600	T	not_revertant	high_impact	snv	no_function	29.3	no	.	.
dpyd	sg48	1475C>T	S492L	S492L	missense_variant	rs72549304	G	A	98015165	G	not_revertant	97549609	G	not_revertant	high_impact	snv	no_function	29.6	no	.	.
dpyd	sg49	1403C>A	T468N	T468N	missense_variant	rs199549923	G	T	98015237	G	not_revertant	97549681	G	not_revertant	low_impact	snv	normal_function	26.9	no	.	.
dpyd	sg50	1371C>T	N457#	N457#	synonymous_variant	rs57918000	G	A	98015269	G	not_revertant	97549713	G	not_revertant	low_impact	snv	normal_function	21.1	no	.	.
dpyd	sg51	1358C>G	P453R	P453R	missense_variant	rs144395748	G	C	98015282	G	not_revertant	97549726	G	not_revertant	high_impact	snv	normal_function	30	no	.	.
dpyd	sg52	1349C>T	A450V	A450V	missense_variant	rs72975710	G	A	98015291	G	not_revertant	97549735	G	not_revertant	low_impact	snv	normal_function	25.8	no	.	.
dpyd	sg53	1314T>G	F438L	F438L	missense_variant	rs186169810	A	C	98039341	A	not_revertant	97573785	A	not_revertant	high_impact	snv	decreased_function	23.2	no	.	.
dpyd	sg54	1294G>A	D432N	D432N	missense_variant	rs142512579	C	T	98039361	C	not_revertant	97573805	C	not_revertant	low_impact	snv	normal_function	22.6	no	.	.
dpyd	sg55	1278G>T	M426I	M426I	missense_variant	rs764666241	C	A	98039377	C	not_revertant	97573821	C	not_revertant	low_impact	snv	normal_function	0.224	no	.	.
dpyd	sg56	1260T>A	N420K	N420K	missense_variant	rs200064537	A	T	98039395	A	not_revertant	97573839	A	not_revertant	low_impact	snv	normal_function	0.018	no	.	.
dpyd	sg57	1236G>A	E412#	E412#	synonymous_variant	rs56038477	C	T	98039419	C	not_revertant	97573863	C	not_revertant	low_impact	snv	.	9.901	no	.	.
dpyd	sg58	1218G>A	M406I	M406I	missense_variant	rs61622928	C	T	98039437	C	not_revertant	97573881	C	not_revertant	low_impact	snv	normal_function	19.69	no	.	.
dpyd	sg59	1181G>T	R394L	R394L	missense_variant	rs143815742	C	A	98039474	C	not_revertant	97573918	C	not_revertant	low_impact	snv	normal_function	23.8	no	.	.
dpyd	sg60	1180C>T	R394W	R394W	missense_variant	rs140602333	G	A	98039475	G	not_revertant	97573919	G	not_revertant	high_impact	snv	normal_function	31	no	.	.
dpyd	sg61	1156G>T	E386X	E386X	stop_gained	rs78060119	C	A	98039499	C	not_revertant	97573943	C	not_revertant	high_impact	snv	no_function	43	yes	.	.
dpyd	sg62	1129-15T>C	no_effect	no_effect	intron_variant	rs56293913	A	G	98039541	A	not_revertant	97573985	A	not_revertant	low_impact	snv	normal_function	7.582	no	.	.
dpyd	sg63	1129-5923C>G	no_effect	no_effect	intron_variant	rs75017182	G	C	98045449	G	not_revertant	97579893	G	not_revertant	low_impact	snv	.	0.436	no	.	.
dpyd	sg64	1108A>G	I370V	I370V	missense_variant	rs72549305	T	C	98058794	T	not_revertant	97593238	T	not_revertant	low_impact	snv	normal_function	20.9	no	.	.
dpyd	sg65	1057C>T	R353C	R353C	missense_variant	rs143154602	G	A	98058845	G	not_revertant	97593289	G	not_revertant	high_impact	snv	no_function	18.85	no	.	.
dpyd	sg66	1024G>A	D342N	D342N	missense_variant	rs183385770	C	T	98058878	C	not_revertant	97593322	C	not_revertant	high_impact	snv	no_function	26	no	.	.
dpyd	sg67	1003G>T	V335L	V335L	missense_variant	rs72549306	C	A	98058899	C	not_revertant	97593343	C	not_revertant	low_impact	snv	normal_function	23.4	no	.	.
dpyd	sg68	967G>A	A323T	A323T	missense_variant	rs201018345	C	T	98058935	C	not_revertant	97593379	C	not_revertant	low_impact	snv	normal_function	22.9	no	.	.
dpyd	sg69	934C>T	L312F	L312F	missense_variant	rs145112791	G	A	98060639	G	not_revertant	97595083	G	not_revertant	low_impact	snv	normal_function	24.1	no	.	.
dpyd	sg70	929T>C	L310S	L310S	missense_variant	rs150437414	A	G	98060644	A	not_revertant	97595088	A	not_revertant	low_impact	snv	normal_function	28.2	no	.	.
dpyd	sg71	868A>G	K290E	K290E	missense_variant	rs146356975	T	C	98060705	T	not_revertant	97595149	T	not_revertant	high_impact	snv	decreased_function	14.75	no	.	.
dpyd	sg72	775A>G	K259E	K259E	missense_variant	rs45589337	T	C	98144726	T	not_revertant	97679170	T	not_revertant	low_impact	snv	normal_function	23.2	no	.	.
dpyd	sg73	763-118A>G	no_effect	no_effect	intron_variant	rs3790387	T	C	98144856	T	not_revertant	97679300	T	not_revertant	low_impact	snv	normal_function	3.388	no	.	.
dpyd	sg74	703C>T	R235W	R235W	missense_variant	rs1801266	G	A	98157332	G	not_revertant	97691776	G	not_revertant	high_impact	snv	no_function	29.5	no	.	.
dpyd	sg75	632A>G	Y211C	Y211C	missense_variant	rs72549307	T	C	98164955	T	not_revertant	97699399	T	not_revertant	high_impact	snv	no_function	27.8	no	.	.
dpyd	sg76	601A>C	S201R	S201R	missense_variant	rs72549308	T	G	98164986	T	not_revertant	97699430	T	not_revertant	high_impact	snv	no_function	26.9	no	.	.
dpyd	sg77	557A>G	Y186C	Y186C	missense_variant	rs115232898	T	C	98165030	T	not_revertant	97699474	T	not_revertant	high_impact	snv	decreased_function	25.9	no	.	.
dpyd	sg78	525G>A	S175#	S175#	synonymous_variant	rs6670886	C	T	98165062	C	not_revertant	97699506	C	not_revertant	low_impact	snv	normal_function	8.613	no	.	.
dpyd	sg79	498G>A	M166I	M166I	missense_variant	rs139834141	C	T	98165089	C	not_revertant	97699533	C	not_revertant	low_impact	snv	normal_function	27.2	no	.	.
dpyd	sg80	496A>G	M166V	M166V	missense_variant	rs2297595	T	C	98165091	T	not_revertant	97699535	T	not_revertant	low_impact	snv	normal_function	24.9	no	.	.
dpyd	sg81	483+18G>A	no_effect	no_effect	intron_variant	rs56276561	C	T	98187048	C	not_revertant	97721492	C	not_revertant	low_impact	snv	.	1.219	no	.	.
dpyd	sg82	451A>G	N151D	N151D	missense_variant	rs200562975	T	C	98187098	T	not_revertant	97721542	T	not_revertant	low_impact	snv	normal_function	24.9	no	.	.
dpyd	sg83	343A>G	M115V	M115V	missense_variant	rs141462178	T	C	98187206	T	not_revertant	97721650	T	not_revertant	low_impact	snv	normal_function	15.64	no	.	.
dpyd	sg84	313G>A	A105T	A105T	missense_variant	rs150385342	C	T	98205956	C	not_revertant	97740400	C	not_revertant	low_impact	snv	normal_function	23.4	no	.	.
dpyd	sg85	295_298delTCAT	frameshift	frameshift	frameshift_variant	rs72549309	AATGA	A	98205970	AATGA	not_revertant	97740414	AATGA	not_revertant	high_impact	indel	no_function	34	yes	.	.
dpyd	sg86	85T>C	C29R	C29R	missense_variant	rs1801265 	A	G	98348885	G	revertant	97883329	A	not_revertant	low_impact	snv	normal_function	23.2	no	.	.
dpyd	sg87	62G>A	R21Q	R21Q	missense_variant	rs80081766	C	T	98348908	C	not_revertant	97883352	C	not_revertant	low_impact	snv	normal_function	23.4	no	.	.
dpyd	sg88	61C>T	R21X	R21X	stop_gained	rs72549310	G	A	98348909	G	not_revertant	97883353	G	not_revertant	high_impact	snv	no_function	38	yes	.	.
dpyd	sg89	46C>G	L16V	L16V	missense_variant	rs150036960	G	C	98348924	G	not_revertant	97883368	G	not_revertant	low_impact	snv	normal_function	25.4	no	.	.
g6pd	sg1	1502T>G	F501C	F501C	missense_variant	.	A	C	153760261	A	not_revertant	154532046	A	not_revertant	moderate_impact	snv	.	29.1	no	.	.
g6pd	sg2	1488_1490delGAA	K497del	K497del	inframe_deletion	.	CTTC	C	153760272	CTTC	not_revertant	154532057	CTTC	not_revertant	high_impact	indel	I/Deficient_with_CNSHA	17.69	no	.	.
g6pd	sg3	1466C>T	P489L	P489L	missense_variant	.	G	A	153760297	G	not_revertant	154532082	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25.2	no	.	.
g6pd	sg4	1465C>T	P489S	P489S	missense_variant	.	G	A	153760298	G	not_revertant	154532083	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.5	no	.	.
g6pd	sg5	1463G>T	G488V	G488V	missense_variant	.	C	A	153760300	C	not_revertant	154532085	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.8	no	.	.
g6pd	sg6	1462G>A	G488S	G488S	missense_variant	.	C	T	153760301	C	not_revertant	154532086	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25.1	no	.	.
g6pd	sg7	1442C>G	P481R	P481R	missense_variant	rs137852348	G	C	153760418	G	not_revertant	154532203	G	not_revertant	high_impact	snv	III/Deficient	22.1	no	.	.
g6pd	sg8	1414A>C	I472L	I472L	missense_variant	.	T	G	153760446	T	not_revertant	154532231	T	not_revertant	moderate_impact	snv	unknown_function	12.86	no	.	.
g6pd	sg9	1400C>G	P467R	P467R	missense_variant	rs137852344	G	C	153760460	G	not_revertant	154532245	G	not_revertant	high_impact	snv	III/Deficient	23.6	no	.	.
g6pd	sg10	1388G>A	R463H	R463H	missense_variant	rs72554664	C	T	153760472	C	not_revertant	154532257	C	not_revertant	high_impact	snv	II/Deficient	25	no	.	.
g6pd	sg11	1387C>T	R463C	R463C	missense_variant	.	G	A	153760473	G	not_revertant	154532258	G	not_revertant	high_impact	snv	III/Deficient	23	no	.	.
g6pd	sg12	1387C>A	R463S	R463S	missense_variant	.	G	T	153760473	G	not_revertant	154532258	G	not_revertant	high_impact	snv	II/Deficient	22.1	no	.	.
g6pd	sg13	1381G>A	A461T	A461T	missense_variant	rs782608284	C	T	153760479	C	not_revertant	154532264	C	not_revertant	moderate_impact	snv	unknown_function	25.5	no	.	.
g6pd	sg14	1380G>C	E460D	E460D	missense_variant	.	C	G	153760480	C	not_revertant	154532265	C	not_revertant	high_impact	snv	III/Deficient	21.5	no	.	.
g6pd	sg15	1376G>T	R459L	R459L	missense_variant	rs72554665	C	A	153760484	C	not_revertant	154532269	C	not_revertant	high_impact	snv	II/Deficient	22.7	no	.	.
g6pd	sg16	1376G>C	R459P	R459P	missense_variant	rs72554665	C	G	153760484	C	not_revertant	154532269	C	not_revertant	high_impact	snv	II/Deficient	24.2	no	.	.
g6pd	sg17	1367A>T	D456V	D456V	missense_variant	.	T	A	153760493	T	not_revertant	154532278	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.8	no	.	.
g6pd	sg18	1366G>C	D456H	D456H	missense_variant	.	C	G	153760494	C	not_revertant	154532279	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	26.8	no	.	.
g6pd	sg19	1361G>A	R454H	R454H	missense_variant	rs137852324	C	T	153760604	C	not_revertant	154532389	C	not_revertant	high_impact	snv	II/Deficient	26	no	.	.
g6pd	sg20	1360C>T	R454C	R454C	missense_variant	rs398123546	G	A	153760605	G	not_revertant	154532390	G	not_revertant	high_impact	snv	II/Deficient	32	no	.	.
g6pd	sg21	1358T>A	V453E	V453E	missense_variant	.	A	T	153760607	A	not_revertant	154532392	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	27.7	no	.	.
g6pd	sg22	1347G>C	Q449H	Q449H	missense_variant	.	C	G	153760618	C	not_revertant	154532403	C	not_revertant	high_impact	snv	II/Deficient	22.8	no	.	.
g6pd	sg23	1342A>G	S448G	S448G	missense_variant	.	T	C	153760623	T	not_revertant	154532408	T	not_revertant	high_impact	snv	II/Deficient	22.7	no	.	.
g6pd	sg24	1339G>A	G447R	G447R	missense_variant	rs137852317	C	T	153760626	C	not_revertant	154532411	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	29.5	no	.	.
g6pd	sg25	1318C>T	L440F	L440F	missense_variant	.	G	A	153760647	G	not_revertant	154532432	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	27.7	no	.	.
g6pd	sg26	1316G>C	R439P	R439P	missense_variant	rs137852337	C	G	153760649	C	not_revertant	154532434	C	not_revertant	high_impact	snv	II/Deficient	32	no	.	.
g6pd	sg27	1292T>G	V431G	V431G	missense_variant	.	A	C	153760673	A	not_revertant	154532458	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.9	no	.	.
g6pd	sg28	1291G>A	V431M	V431M	missense_variant	rs782098548	C	T	153760674	C	not_revertant	154532459	C	not_revertant	high_impact	snv	II/Deficient	22.9	no	.	.
g6pd	sg29	1284C>A	Y428X	Y428X	stop_gained	.	G	T	153760785	G	not_revertant	154532570	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	39	yes	.	.
g6pd	sg30	1264C>G	L422V	L422V	missense_variant	.	G	C	153760805	G	not_revertant	154532590	G	not_revertant	moderate_impact	snv	.	24.3	no	.	.
g6pd	sg31	1246G>A	E416K	E416K	missense_variant	.	C	T	153760823	C	not_revertant	154532608	C	not_revertant	high_impact	snv	I-II/Deficient_with_CNSHA-Deficient	23.1	no	.	.
g6pd	sg32	1231A>G	M411V	M411V	missense_variant	.	T	C	153760838	T	not_revertant	154532623	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	16.26	no	.	.
g6pd	sg33	1229G>C	G410A	G410A	missense_variant	rs137852336	C	G	153760840	C	not_revertant	154532625	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.6	no	.	.
g6pd	sg34	1229G>A	G410D	G410D	missense_variant	rs137852336	C	T	153760840	C	not_revertant	154532625	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.2	no	.	.
g6pd	sg35	1228G>T	G410C	G410C	missense_variant	rs137852323	C	A	153760841	C	not_revertant	154532626	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.7	no	.	.
g6pd	sg36	1226C>G	P409R	P409R	missense_variant	.	G	C	153760843	G	not_revertant	154532628	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25.6	no	.	.
g6pd	sg37	1225C>T	P409S	P409S	missense_variant	.	G	A	153760844	G	not_revertant	154532629	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.8	no	.	.
g6pd	sg38	1220A>C	K407T	K407T	missense_variant	.	T	G	153760849	T	not_revertant	154532634	T	not_revertant	high_impact	snv	II/Deficient	26.4	no	.	.
g6pd	sg39	1215G>A	M405I	M405I	missense_variant	.	C	T	153760854	C	not_revertant	154532639	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	22.7	no	.	.
g6pd	sg40	1205C>A	T402N	T402N	missense_variant	.	G	T	153760864	G	not_revertant	154532649	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.9	no	.	.
g6pd	sg41	1193A>G	E398G	E398G	missense_variant	.	T	C	153760876	T	not_revertant	154532661	T	not_revertant	high_impact	snv	II/Deficient	27.7	no	.	.
g6pd	sg42	1192G>A	E398K	E398K	missense_variant	rs137852325	C	T	153760877	C	not_revertant	154532662	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	26	no	.	.
g6pd	sg43	1187C>T	P396L	P396L	missense_variant	.	G	A	153760882	G	not_revertant	154532667	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	26.9	no	.	.
g6pd	sg44	1180G>C	V394L	V394L	missense_variant	rs137852335	C	G	153760889	C	not_revertant	154532674	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	18.31	no	.	.
g6pd	sg45	1178G>A	R393H	R393H	missense_variant	rs137852316	C	T	153760891	C	not_revertant	154532676	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	27.6	no	.	.
g6pd	sg46	1177C>G	R393G	R393G	missense_variant	.	G	C	153760892	G	not_revertant	154532677	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.7	no	.	.
g6pd	sg47	1175T>C	I392T	I392T	missense_variant	.	A	G	153760894	A	not_revertant	154532679	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.8	no	.	.
g6pd	sg48	1166A>G	E389G	E389G	missense_variant	.	T	C	153760903	T	not_revertant	154532688	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	27.3	no	.	.
g6pd	sg49	1162A>G	N388D	N388D	missense_variant	.	T	C	153760907	T	not_revertant	154532692	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25.3	no	.	.
g6pd	sg50	1160G>A	R387H	R387H	missense_variant	rs137852321	C	T	153760909	C	not_revertant	154532694	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.9	no	.	.
g6pd	sg51	1159C>T	R387C	R387C	missense_variant	rs137852334	G	A	153760910	G	not_revertant	154532695	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	26.9	no	.	.
g6pd	sg52	1156A>G	K386E	K386E	missense_variant	rs137852320	T	C	153760913	T	not_revertant	154532698	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	22.4	no	.	.
g6pd	sg53	1155C>G	C385W	C385W	missense_variant	.	G	C	153760914	G	not_revertant	154532699	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.9	no	.	.
g6pd	sg54	1154G>T	C385F	C385F	missense_variant	.	C	A	153760915	C	not_revertant	154532700	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.7	no	.	.
g6pd	sg55	1153T>C	C385R	C385R	missense_variant	rs137852322	A	G	153760916	A	not_revertant	154532701	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.8	no	.	.
g6pd	sg56	1141T>C	F381L	F381L	missense_variant	.	A	G	153760928	A	not_revertant	154532713	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	28.9	no	.	.
g6pd	sg57	1139T>C	I380T	I380T	missense_variant	.	A	G	153760930	A	not_revertant	154532715	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	26.7	no	.	.
g6pd	sg58	1138A>G	I380V	I380V	missense_variant	.	T	C	153760931	T	not_revertant	154532716	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.4	no	.	.
g6pd	sg59	1132G>A	G378S	G378S	missense_variant	rs371489738	C	T	153760937	C	not_revertant	154532722	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23	no	.	.
g6pd	sg60	1084_1101delCTGAACGAGCGCAAGGCC	L362_A367del	L362_A367del	inframe_deletion	.	CGGCCTTGCGCTCGTTCAG	C	153760967	CGGCCTTGCGCTCGTTCAG	not_revertant	154532752	CGGCCTTGCGCTCGTTCAG	not_revertant	high_impact	indel	I/Deficient_with_CNSHA	17.1	no	.	.
g6pd	sg61	1096A>G	K366E	K366E	missense_variant	.	T	C	153760973	T	not_revertant	154532758	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.3	no	.	.
g6pd	sg62	1089C>G	N363K	N363K	missense_variant	rs137852329	G	C	153760980	G	not_revertant	154532765	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	14.68	no	.	.
g6pd	sg63	1089C>A	N363K	N363K	missense_variant	rs137852329	G	T	153760980	G	not_revertant	154532765	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	14.72	no	.	.
g6pd	sg64	1082C>T	A361V	A361V	missense_variant	rs137852345	G	A	153760987	G	not_revertant	154532772	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25.1	no	.	.
g6pd	sg65	1081G>A	A361T	A361T	missense_variant	.	C	T	153760988	C	not_revertant	154532773	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25	no	.	.
g6pd	sg66	1057C>T	P353S	P353S	missense_variant	rs137852333	G	A	153761012	G	not_revertant	154532797	G	not_revertant	high_impact	snv	II/Deficient	24.9	no	.	.
g6pd	sg67	1052G>T	G351V	G351V	missense_variant	.	C	A	153761017	C	not_revertant	154532802	C	not_revertant	high_impact	snv	II/Deficient	29.2	no	.	.
g6pd	sg68	1048G>C	D350H	D350H	missense_variant	rs34193178	C	G	153761160	C	not_revertant	154532945	C	not_revertant	moderate_impact	snv	IV/Normal	22.9	no	.	.
g6pd	sg69	1037A>T	N346I	N346I	missense_variant	rs398123544	T	A	153761171	T	not_revertant	154532956	T	not_revertant	moderate_impact	snv	.	25	no	.	.
g6pd	sg70	1024C>T	L342F	L342F	missense_variant	rs137852342	G	A	153761184	G	not_revertant	154532969	G	not_revertant	high_impact	snv	III/Deficient	15.53	no	.	.
g6pd	sg71	1006A>G	T336A	T336A	missense_variant	.	T	C	153761202	T	not_revertant	154532987	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.1	no	.	.
g6pd	sg72	1004C>A	A335D	A335D	missense_variant	.	G	T	153761204	G	not_revertant	154532989	G	not_revertant	high_impact	snv	II/Deficient	23.2	no	.	.
g6pd	sg73	1000_1002delACC	T334del	T334del	inframe_deletion	.	CGGTGGT	CGGT	153761205	CGGTGGT	not_revertant	154532990	CGGTGGT	not_revertant	high_impact	indel	I/Deficient_with_CNSHA	14.83	no	.	.
g6pd	sg74	1003G>A	A335T	A335T	missense_variant	rs5030869	C	T	153761205	C	not_revertant	154532990	C	not_revertant	high_impact	snv	II/Deficient	23.6	no	.	.
g6pd	sg75	989G>A	R330H	R330H	missense_variant	rs868950643	C	T	153761219	C	not_revertant	154533004	C	not_revertant	moderate_impact	snv	IV/Normal	2.813	no	.	.
g6pd	sg76	955_988delACCAAAGGGTACCTGGACGACCCC	T319_P326del	T319_P326del	inframe_deletion	.	TGGGGTCGTCCAGGTACCCTTTGGT	T	153761229	TGGGGTCGTCCAGGTACCCTTTGGT	not_revertant	154533014	TGGGGTCGTCCAGGTACCCTTTGGT	not_revertant	high_impact	indel	I/Deficient_with_CNSHA	19.35	no	.	.
g6pd	sg77	977C>A	P326H	P326H	missense_variant	rs1379306569	G	T	153761231	G	not_revertant	154533016	G	not_revertant	high_impact	snv	II-III/Deficient	23.1	no	.	.
g6pd	sg78	968T>C	L323P	L323P	missense_variant	rs76723693	A	G	153761240	A	not_revertant	154533025	A	not_revertant	moderate_impact	snv	.	23.3	no	.	.
g6pd	sg79	964T>C	Y322H	Y322H	missense_variant	rs137852347	A	G	153761244	A	not_revertant	154533029	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.7	no	.	.
g6pd	sg80	962G>A	G321E	G321E	missense_variant	.	C	T	153761246	C	not_revertant	154533031	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25.8	no	.	.
g6pd	sg81	949G>A	E317K	E317K	missense_variant	rs137852339	C	T	153761259	C	not_revertant	154533044	C	not_revertant	high_impact	snv	III/Deficient	22.3	no	.	.
g6pd	sg82	929G>A	G310E	G310E	missense_variant	.	C	T	153761279	C	not_revertant	154533064	C	not_revertant	high_impact	snv	II/Deficient	21.7	no	.	.
g6pd	sg83	921G>C	Q307H	Q307H	missense_variant	.	C	G	153761287	C	not_revertant	154533072	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	22.2	no	.	.
g6pd	sg84	916G>A	G306S	G306S	missense_variant	.	C	T	153761292	C	not_revertant	154533077	C	not_revertant	high_impact	snv	II/Deficient	25.2	no	.	.
g6pd	sg85	910G>T	V304F	V304F	missense_variant	.	C	A	153761298	C	not_revertant	154533083	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25	no	.	.
g6pd	sg86	871G>A	V291M	V291M	missense_variant	rs137852327	C	T	153761337	C	not_revertant	154533122	C	not_revertant	high_impact	snv	II/Deficient	25.9	no	.	.
g6pd	sg87	854G>A	R285H	R285H	missense_variant	rs74575103	C	T	153761801	C	not_revertant	154533586	C	not_revertant	high_impact	snv	III/Deficient	26.6	no	.	.
g6pd	sg88	853C>T	R285C	R285C	missense_variant	.	G	A	153761802	G	not_revertant	154533587	G	not_revertant	high_impact	snv	II/Deficient	24.6	no	.	.
g6pd	sg89	851T>C	V284A	V284A	missense_variant	.	A	G	153761804	A	not_revertant	154533589	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.6	no	.	.
g6pd	sg90	849C>A	D283E	D283E	missense_variant	rs192737996	G	T	153761806	G	not_revertant	154533591	G	not_revertant	moderate_impact	snv	unknown_function	17.3	no	.	.
g6pd	sg91	848A>G	D283G	D283G	missense_variant	.	T	C	153761807	T	not_revertant	154533592	T	not_revertant	high_impact	snv	II/Deficient	25	no	.	.
g6pd	sg92	844G>T	D282Y	D282Y	missense_variant	rs137852318	C	A	153761811	C	not_revertant	154533596	C	not_revertant	high_impact	snv	III/Deficient	24.4	no	.	.
g6pd	sg93	844G>C	D282H	D282H	missense_variant	rs137852318	C	G	153761811	C	not_revertant	154533596	C	not_revertant	high_impact	snv	III/Deficient	24.1	no	.	.
g6pd	sg94	835A>T	T279S	T279S	missense_variant	.	T	A	153761820	T	not_revertant	154533605	T	not_revertant	high_impact	snv	II/Deficient	18.22	no	.	.
g6pd	sg95	835A>G	T279A	T279A	missense_variant	.	T	C	153761820	T	not_revertant	154533605	T	not_revertant	high_impact	snv	II/Deficient	18.09	no	.	.
g6pd	sg96	833C>T	S278F	S278F	missense_variant	.	G	A	153761822	G	not_revertant	154533607	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	26.2	no	.	.
g6pd	sg97	832T>C	S278P	S278P	missense_variant	.	A	G	153761823	A	not_revertant	154533608	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.3	no	.	.
g6pd	sg98	826C>T	P276S	P276S	missense_variant	.	G	A	153761829	G	not_revertant	154533614	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25.5	no	.	.
g6pd	sg99	825G>C	K275N	K275N	missense_variant	.	C	G	153761830	C	not_revertant	154533615	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.9	no	.	.
g6pd	sg100	821A>T	E274V	E274V	missense_variant	.	T	A	153761834	T	not_revertant	154533619	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.9	no	.	.
g6pd	sg101	820G>A	E274K	E274K	missense_variant	.	C	T	153761835	C	not_revertant	154533620	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.5	no	.	.
g6pd	sg102	811G>C	V271L	V271L	missense_variant	.	C	G	153761844	C	not_revertant	154533629	C	not_revertant	high_impact	snv	II/Deficient	19.61	no	.	.
g6pd	sg103	806G>A	C269Y	C269Y	missense_variant	rs137852346	C	T	153761849	C	not_revertant	154533634	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25.8	no	.	.
g6pd	sg104	769C>G	R257G	R257G	missense_variant	.	G	C	153762251	G	not_revertant	154534036	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	24.9	no	.	.
g6pd	sg105	724_729delGGCACT	G242_T243del	G242_T243del	inframe_deletion	.	CAGTGCC	C	153762290	CAGTGCC	not_revertant	154534075	CAGTGCC	not_revertant	high_impact	indel	I/Deficient_with_CNSHA	17.61	no	.	.
g6pd	sg106	713A>G	K238R	K238R	missense_variant	.	T	C	153762307	T	not_revertant	154534092	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.9	no	.	.
g6pd	sg107	703C>T	L235F	L235F	missense_variant	rs782757170	G	A	153762317	G	not_revertant	154534102	G	not_revertant	high_impact	snv	III/Deficient	23	no	.	.
g6pd	sg108	695G>A	C232Y	C232Y	missense_variant	.	C	T	153762325	C	not_revertant	154534110	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	22.7	no	.	.
g6pd	sg109	683_685delACA	N229del	N229del	inframe_deletion	.	ATGTTGT	ATGT	153762331	ATGTTGT	not_revertant	154534116	ATGTTGT	not_revertant	high_impact	indel	I/Deficient_with_CNSHA	17.98	no	.	.
g6pd	sg110	680G>T	R227L	R227L	missense_variant	rs137852328	C	A	153762340	C	not_revertant	154534125	C	not_revertant	moderate_impact	snv	.	23.8	no	.	.
g6pd	sg111	680G>A	R227Q	R227Q	missense_variant	rs137852328	C	T	153762340	C	not_revertant	154534125	C	not_revertant	high_impact	snv	III/Deficient	22.6	no	.	.
g6pd	sg112	679C>T	R227W	R227W	missense_variant	.	G	A	153762341	G	not_revertant	154534126	G	not_revertant	high_impact	snv	II/Deficient	27.2	no	.	.
g6pd	sg113	648T>G	F216L	F216L	missense_variant	rs137852319	A	C	153762372	A	not_revertant	154534157	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.6	no	.	.
g6pd	sg114	637G>T	V213L	V213L	missense_variant	rs137852326	C	A	153762560	C	not_revertant	154534345	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	22.8	no	.	.
g6pd	sg115	634A>G	M212V	M212V	missense_variant	rs782754619	T	C	153762563	T	not_revertant	154534348	T	not_revertant	high_impact	snv	III/Deficient	23.8	no	.	.
g6pd	sg116	595A>G	I199V	I199V	missense_variant	rs781865768	T	C	153762602	T	not_revertant	154534387	T	not_revertant	moderate_impact	snv	unknown_function	24.2	no	.	.
g6pd	sg117	593G>C	R198P	R198P	missense_variant	rs137852332	C	G	153762604	C	not_revertant	154534389	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	25.3	no	.	.
g6pd	sg118	593G>A	R198H	R198H	missense_variant	rs137852332	C	T	153762604	C	not_revertant	154534389	C	not_revertant	high_impact	snv	II/Deficient	25.3	no	.	.
g6pd	sg119	592C>T	R198C	R198C	missense_variant	rs137852330	G	A	153762605	G	not_revertant	154534390	G	not_revertant	high_impact	snv	II/Deficient	32	no	.	.
g6pd	sg120	573C>G	F191L	F191L	missense_variant	.	G	C	153762624	G	not_revertant	154534409	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	22.7	no	.	.
g6pd	sg121	561_563delCTC	S188del	S188del	inframe_deletion	.	GGAG	G	153762633	GGAG	not_revertant	154534418	GGAG	not_revertant	high_impact	indel	I/Deficient_with_CNSHA	22.2	no	.	.
g6pd	sg122	563C>T	S188F	S188F	missense_variant	rs5030868	G	A	153762634	G	not_revertant	154534419	G	not_revertant	high_impact	snv	II/Deficient	24.7	no	.	.
g6pd	sg123	544C>T	R182W	R182W	missense_variant	rs267606836	G	A	153762653	G	not_revertant	154534438	G	not_revertant	moderate_impact	snv	.	17.86	no	.	.
g6pd	sg124	542A>T	D181V	D181V	missense_variant	rs5030872	T	A	153762655	T	not_revertant	154534440	T	not_revertant	high_impact	snv	III/Deficient	16.56	no	.	.
g6pd	sg125	535A>T	S179C	S179C	missense_variant	.	T	A	153762662	T	not_revertant	154534447	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.7	no	.	.
g6pd	sg126	527A>G	D176G	D176G	missense_variant	.	T	C	153762670	T	not_revertant	154534455	T	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	27.9	no	.	.
g6pd	sg127	519C>G	F173L	F173L	missense_variant	rs200111236	G	C	153762678	G	not_revertant	154534463	G	not_revertant	high_impact	snv	II/Deficient	23.3	no	.	.
g6pd	sg128	517T>C	F173L	F173L	missense_variant	rs137852343	A	G	153762680	A	not_revertant	154534465	A	not_revertant	high_impact	snv	II/Deficient	28	no	.	.
g6pd	sg129	514C>T	P172S	P172S	missense_variant	.	G	A	153762683	G	not_revertant	154534468	G	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	26.6	no	.	.
g6pd	sg130	497G>A	R166H	R166H	missense_variant	.	C	T	153762700	C	not_revertant	154534485	C	not_revertant	high_impact	snv	II/Deficient	33	no	.	.
g6pd	sg131	496C>T	R166C	R166C	missense_variant	.	G	A	153762701	G	not_revertant	154534486	G	not_revertant	high_impact	snv	II/Deficient	33	no	.	.
g6pd	sg132	493A>G	N165D	N165D	missense_variant	rs137852331	T	C	153762704	T	not_revertant	154534489	T	not_revertant	high_impact	snv	II/Deficient	23.2	no	.	.
g6pd	sg133	488G>A	G163D	G163D	missense_variant	.	C	T	153762709	C	not_revertant	154534494	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	29.1	no	.	.
g6pd	sg134	487G>A	G163S	G163S	missense_variant	rs137852314	C	T	153762710	C	not_revertant	154534495	C	not_revertant	high_impact	snv	III/Deficient	27.2	no	.	.
g6pd	sg135	477G>C	M159I	M159I	missense_variant	rs370918918	C	G	153763391	C	not_revertant	154535176	C	not_revertant	moderate_impact	snv	unknown_function	22.3	no	.	.
g6pd	sg136	473G>A	C158Y	C158Y	missense_variant	rs782487723	C	T	153763395	C	not_revertant	154535180	C	not_revertant	high_impact	snv	II/Deficient	26.6	no	.	.
g6pd	sg137	466G>A	E156K	E156K	missense_variant	rs137852313	C	T	153763402	C	not_revertant	154535187	C	not_revertant	high_impact	snv	III/Deficient	13.21	no	.	.
g6pd	sg138	463C>G	H155D	H155D	missense_variant	.	G	C	153763405	G	not_revertant	154535190	G	not_revertant	moderate_impact	snv	.	17.04	no	.	.
g6pd	sg139	442G>A	E148K	E148K	missense_variant	rs1191977862	C	T	153763426	C	not_revertant	154535211	C	not_revertant	high_impact	snv	II/Deficient	15.36	no	.	.
g6pd	sg140	409C>T	L137F	L137F	missense_variant	.	G	A	153763459	G	not_revertant	154535244	G	not_revertant	high_impact	snv	II/Deficient	25.9	no	.	.
g6pd	sg141	406C>T	R136C	R136C	missense_variant	rs979416826	G	A	153763462	G	not_revertant	154535247	G	not_revertant	high_impact	snv	II/Deficient	27.1	no	.	.
g6pd	sg142	404A>C	N135T	N135T	missense_variant	rs782322505	T	G	153763464	T	not_revertant	154535249	T	not_revertant	moderate_impact	snv	unknown_function	25	no	.	.
g6pd	sg143	392G>T	G131V	G131V	missense_variant	rs137852341	C	A	153763476	C	not_revertant	154535261	C	not_revertant	high_impact	snv	III/Deficient	22.6	no	.	.
g6pd	sg144	384C>T	L128#	L128#	synonymous_variant	.	G	A	153763484	G	not_revertant	154535269	G	not_revertant	low_impact	snv	.	0.276	no	.	.
g6pd	sg145	383T>G	L128R	L128R	missense_variant	rs78365220	A	C	153763485	A	not_revertant	154535270	A	not_revertant	high_impact	snv	III/Deficient	22.7	no	.	.
g6pd	sg146	383T>C	L128P	L128P	missense_variant	rs78365220	A	G	153763485	A	not_revertant	154535270	A	not_revertant	high_impact	snv	II/Deficient	23.9	no	.	.
g6pd	sg147	379G>T	A127S	A127S	missense_variant	.	C	A	153763489	C	not_revertant	154535274	C	not_revertant	moderate_impact	snv	.	1.372	no	.	.
g6pd	sg148	376A>G	N126D	N126D	missense_variant	rs1050829	T	C	153763492	T	not_revertant	154535277	T	not_revertant	moderate_impact	snv	IV/Normal	8.194	no	.	.
g6pd	sg149	375G>T	M125I	M125I	missense_variant	.	C	A	153763493	C	not_revertant	154535278	C	not_revertant	moderate_impact	snv	.	1.521	no	.	.
g6pd	sg150	352T>C	Y118H	Y118H	missense_variant	.	A	G	153763516	A	not_revertant	154535301	A	not_revertant	high_impact	snv	II/Deficient	23.3	no	.	.
g6pd	sg151	337G>A	D113N	D113N	missense_variant	rs5030870	C	T	153763531	C	not_revertant	154535316	C	not_revertant	moderate_impact	snv	IV/Normal	11.09	no	.	.
g6pd	sg152	323T>A	V108E	V108E	missense_variant	.	A	T	153763545	A	not_revertant	154535330	A	not_revertant	high_impact	snv	III/Deficient	23.9	no	.	.
g6pd	sg153	317C>G	S106C	S106C	missense_variant	rs267606835	G	C	153763551	G	not_revertant	154535336	G	not_revertant	moderate_impact	snv	.	23.1	no	.	.
g6pd	sg154	311G>A	R104H	R104H	missense_variant	rs181277621	C	T	153763557	C	not_revertant	154535342	C	not_revertant	moderate_impact	snv	.	14.86	no	.	.
g6pd	sg155	281_283delAGA	K95del	K95del	inframe_deletion	.	TTCT	T	153763584	TTCT	not_revertant	154535369	TTCT	not_revertant	high_impact	indel	I/Deficient_with_CNSHA	21.4	no	.	.
g6pd	sg156	274C>T	P92S	P92S	missense_variant	.	G	A	153763594	G	not_revertant	154535379	G	not_revertant	high_impact	snv	III/Deficient	16.83	no	.	.
g6pd	sg157	242G>A	R81H	R81H	missense_variant	rs782308266	C	T	153764177	C	not_revertant	154535962	C	not_revertant	high_impact	snv	III/Deficient	22.5	no	.	.
g6pd	sg158	241C>T	R81C	R81C	missense_variant	rs138687036	G	A	153764178	G	not_revertant	154535963	G	not_revertant	high_impact	snv	III/Deficient	20.9	no	.	.
g6pd	sg159	224T>C	L75P	L75P	missense_variant	.	A	G	153764195	A	not_revertant	154535980	A	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	23.8	no	.	.
g6pd	sg160	209A>G	Y70C	Y70C	missense_variant	.	T	C	153764210	T	not_revertant	154535995	T	not_revertant	high_impact	snv	III/Deficient	21.6	no	.	.
g6pd	sg161	208T>C	Y70H	Y70H	missense_variant	rs137852349	A	G	153764211	A	not_revertant	154535996	A	not_revertant	high_impact	snv	II/Deficient	24	no	.	.
g6pd	sg162	202G>A	V68M	V68M	missense_variant	rs1050828	C	T	153764217	C	not_revertant	154536002	C	not_revertant	high_impact	snv	III/Deficient	24.3	no	.	.
g6pd	sg163	196T>A	F66I	F66I	missense_variant	.	A	T	153764223	A	not_revertant	154536008	A	not_revertant	high_impact	snv	II/Deficient	18.78	no	.	.
g6pd	sg164	185C>T	P62L	P62L	missense_variant	.	G	A	153764234	G	not_revertant	154536019	G	not_revertant	high_impact	snv	III/Deficient	23.7	no	.	.
g6pd	sg165	185C>A	P62H	P62H	missense_variant	.	G	T	153764234	G	not_revertant	154536019	G	not_revertant	high_impact	snv	II/Deficient	23.6	no	.	.
g6pd	sg166	180_182delTCT	L61del	L61del	inframe_deletion	.	CAGA	C	153764236	CAGA	not_revertant	154536021	CAGA	not_revertant	high_impact	indel	I/Deficient_with_CNSHA	15.25	no	.	.
g6pd	sg167	179T>C	L60P	L60P	missense_variant	.	A	G	153764240	A	not_revertant	154536025	A	not_revertant	high_impact	snv	II/Deficient	22.7	no	.	.
g6pd	sg168	172G>A	D58N	D58N	missense_variant	rs137852315	C	T	153764247	C	not_revertant	154536032	C	not_revertant	high_impact	snv	III/Deficient	23.2	no	.	.
g6pd	sg169	170G>A	R57E	R57E	missense_variant	.	C	T	153764249	C	not_revertant	154536034	C	not_revertant	high_impact	snv	III/Deficient	17.8	no	.	.
g6pd	sg170	169C>T	R57W	R57W	missense_variant	.	G	A	153764250	G	not_revertant	154536035	G	not_revertant	high_impact	snv	II/Deficient	26.3	no	.	.
g6pd	sg171	159G>C	W53C	W53C	missense_variant	.	C	G	153764260	C	not_revertant	154536045	C	not_revertant	high_impact	snv	I/Deficient_with_CNSHA	33	no	.	.
g6pd	sg172	148C>T	P50S	P50S	missense_variant	.	G	A	153764366	G	not_revertant	154536151	G	not_revertant	high_impact	snv	III/Deficient	26.3	no	.	.
g6pd	sg173	143T>C	I48T	I48T	missense_variant	rs76645461	A	G	153764371	A	not_revertant	154536156	A	not_revertant	high_impact	snv	III/Deficient	21.5	no	.	.
g6pd	sg174	131C>G	A44G	A44G	missense_variant	rs78478128	G	C	153764383	G	not_revertant	154536168	G	not_revertant	high_impact	snv	III/Deficient	27.8	no	.	.
g6pd	sg175	130G>A	A44T	A44T	missense_variant	.	C	T	153764384	C	not_revertant	154536169	C	not_revertant	high_impact	snv	III/Deficient	28.6	no	.	.
g6pd	sg176	103_105delATC	I35del	I35del	inframe_deletion	rs137852338	ATGATGATGA	ATGATGA	153774261	ATGATGATGA	not_revertant	154546046	ATGATGATGA	not_revertant	high_impact	indel	I/Deficient_with_CNSHA	18.07	no	.	.
g6pd	sg177	110T>C	M37T	M37T	missense_variant	.	A	G	153774261	A	not_revertant	154546046	A	not_revertant	moderate_impact	snv	unknown_function	22.7	no	.	.
g6pd	sg178	99A>G	I33M	I33M	missense_variant	rs1163458456	T	C	153774272	T	not_revertant	154546057	T	not_revertant	moderate_impact	snv	.	14.54	no	.	.
g6pd	sg179	95A>G	H32R	H32R	missense_variant	rs137852340	T	C	153774276	T	not_revertant	154546061	T	not_revertant	high_impact	snv	III/Deficient	21.9	no	.	.
g6pd	sg180	40G>A	G14R	G14R	missense_variant	.	C	T	153774331	C	not_revertant	154546116	C	not_revertant	high_impact	snv	III/Deficient	23.9	no	.	.
g6pd	sg181	34G>T	V12L	V12L	missense_variant	rs797043472	C	A	153774337	C	not_revertant	154546122	C	not_revertant	high_impact	snv	III/Deficient	21	no	.	.
g6pd	sg182	25C>T	R9W	R9W	missense_variant	rs1273138455	G	A	153774346	G	not_revertant	154546131	G	not_revertant	moderate_impact	snv	unknown_function	23.3	no	.	.
gstm1	sg1	519G>C	K173N	K173N	missense_variant	rs1065411	G	C	110233138	G	not_revertant	109690516	G	not_revertant	moderate_impact	snv	normal_function	7.088	no	.	.
gstp1	sg1	313A>G	I105V	I105V	missense_variant	rs1695	A	G	67352689	A	not_revertant	67585218	A	not_revertant	moderate_impact	snv	unknown_function	0.035	no	.	.
gstp1	sg2	341C>T	A114V	A114V	missense_variant	rs1138272	C	T	67353579	C	not_revertant	67586108	C	not_revertant	moderate_impact	snv	unknown_function	12.43	no	.	.
gstt1	sg1	310A>C	T104P	T104P	missense_variant	rs11550605	T	G	24379402	T	not_revertant	273577	T	not_revertant	high_impact	snv	no_function	24	no	.	.
ifnl3	sg1	.	no_effect	no_effect	downstream_gene_variant	rs12980275	A	G	39731783	A	not_revertant	39241143	A	not_revertant	high_impact	snv	IFNL3_Unfavorable_Response	0.169	no	.	.
ifnl3	sg2	NG_042193.1:g.1825G>A	no_effect	no_effect	upstream_gene_variant	rs12979860	C	T	39738787	C	not_revertant	39248147	C	not_revertant	high_impact	snv	IFNL3_Unfavorable_Response	6.01	no	.	.
ifnl3	sg3	.	no_effect	no_effect	upstream_gene_variant	rs8099917	T	G	39743165	T	not_revertant	39252525	T	not_revertant	high_impact	snv	IFNL3_Unfavorable_Response	11.65	no	.	.
nat1	sg1	-344C>T	no_effect	no_effect	5_prime_UTR_variant	rs4986988	C	T	18079213	C	not_revertant	18221704	C	not_revertant	low_impact	snv	.	0.195	no	.	.
nat1	sg2	-40A>T	no_effect	no_effect	5_prime_UTR_variant	rs4986989	A	T	18079517	A	not_revertant	18222008	A	not_revertant	low_impact	snv	.	5.872	no	.	.
nat1	sg3	21T>G	L7#	L7#	synonymous_variant	rs4986992	T	G	18079577	T	not_revertant	18222068	T	not_revertant	low_impact	snv	.	8.537	no	.	.
nat1	sg4	97C>T	R33X	R33X	stop_gained	rs56318881	C	T	18079653	C	not_revertant	18222144	C	not_revertant	high_impact	snv	no_function	35	yes	.	.
nat1	sg5	190C>T	R64W	R64W	missense_variant	rs56379106	C	T	18079746	C	not_revertant	18222237	C	not_revertant	high_impact	snv	decreased_function	22.9	no	.	.
nat1	sg6	350_351GG>CC	R117T	R117T	missense_variant	rs72554606	GG	CC	18079906	GG	not_revertant	18222397	GG	not_revertant	moderate_impact	indel	.	6.18	no	.	.
nat1	sg7	402T>C	P134#	P134#	synonymous_variant	rs146727732	T	C	18079958	T	not_revertant	18222449	T	not_revertant	low_impact	snv	normal_function	9.54	no	.	.
nat1	sg8	445G>A	V149I	V149I	missense_variant	rs4987076	G	A	18080001	G	not_revertant	18222492	G	not_revertant	moderate_impact	snv	unknown_function	4.046	no	.	.
nat1	sg9	459G>A	T153#	T153#	synonymous_variant	rs4986990	G	A	18080015	G	not_revertant	18222506	G	not_revertant	low_impact	snv	.	4.425	no	.	.
nat1	sg10	497_499GGG>CCC	frameshift	frameshift	frameshift_variant	rs72554608	GGG	CCC	18080053	GGG	not_revertant	18222544	GGG	not_revertant	high_impact	indel	.	15.22	yes	.	.
nat1	sg11	559C>T	R187X	R187X	stop_gained	rs5030839	C	T	18080115	C	not_revertant	18222606	C	not_revertant	high_impact	snv	no_function	35	yes	.	.
nat1	sg12	560G>A	R187Q	R187Q	missense_variant	rs4986782	G	A	18080116	G	not_revertant	18222607	G	not_revertant	high_impact	snv	decreased_function	15.64	no	.	.
nat1	sg13	613A>G	M205V	M205V	missense_variant	rs72554609	A	G	18080169	A	not_revertant	18222660	A	not_revertant	moderate_impact	snv	normal_function	1.175	no	.	.
nat1	sg14	640T>G	S214A	S214A	missense_variant	rs4986783	T	G	18080196	T	not_revertant	18222687	T	not_revertant	moderate_impact	snv	.	0.046	no	.	.
nat1	sg15	752A>T	D251V	D251V	missense_variant	rs56172717	A	T	18080308	A	not_revertant	18222799	A	not_revertant	high_impact	snv	decreased_function	23.8	no	.	.
nat1	sg16	777T>C	S259#	S259#	synonymous_variant	rs4986991	T	C	18080333	T	not_revertant	18222824	T	not_revertant	low_impact	snv	normal_function	0.505	no	.	.
nat1	sg17	781G>A	E261K	E261K	missense_variant	rs72554610	G	A	18080337	G	not_revertant	18222828	G	not_revertant	moderate_impact	snv	normal_function	22	no	.	.
nat1	sg18	787A>G	I263V	I263V	missense_variant	rs72554611	A	G	18080343	A	not_revertant	18222834	A	not_revertant	moderate_impact	snv	normal_function	2.133	no	.	.
nat1	sg19	884A>G	no_effect	no_effect	3_prime_UTR_variant	rs55793712	A	G	18080440	A	not_revertant	18222931	A	not_revertant	low_impact	snv	.	4.911	no	.	.
nat1	sg20	976delA	no_effect	no_effect	3_prime_UTR_variant	rs72554612	AA	A	18080531	AA	not_revertant	18223022	AA	not_revertant	low_impact	indel	.	7.901	no	.	.
nat1	sg21	1025delT	no_effect	no_effect	3_prime_UTR_variant	rs8190859	TT	T	18080580	TT	not_revertant	18223072	TT	not_revertant	low_impact	indel	.	0.576	no	.	.
nat1	sg22	1064_1066delAAA	no_effect	no_effect	3_prime_UTR_variant	rs4646271	CAAA	C	18080619	CAAA	not_revertant	18223110	CAAA	not_revertant	low_impact	indel	unknown_function	2.76	no	.	.
nat1	sg23	1064_1065insAAT	no_effect	no_effect	3_prime_UTR_variant	rs567144265 	A	AAAT	18080620	A	not_revertant	18223111	A	not_revertant	low_impact	indel	unknown_function	2.872	no	.	.
nat1	sg24	1080_1088delAATAATAAA	no_effect	no_effect	3_prime_UTR_variant	rs367921464	TAATAATAAA	T	18080635	TAATAATAAA	not_revertant	18223126	TAATAATAAA	not_revertant	low_impact	indel	.	0.528	no	.	.
nat1	sg25	1083_1088delTAATAA	no_effect	no_effect	3_prime_UTR_variant	rs932721238	TAATAAA	T	18080638	TAATAAA	not_revertant	18223129	TAATAAA	not_revertant	low_impact	indel	unknown_function	0.588	no	.	.
nat1	sg26	1088T>A	no_effect	no_effect	3_prime_UTR_variant	rs1057126	T	A	18080644	A	revertant	18223135	A	revertant	low_impact	snv	.	0.242	no	.	.
nat1	sg27	1091_1092insAAA	no_effect	no_effect	3_prime_UTR_variant	.	A	AAAA	18080647	A	not_revertant	18223138	A	not_revertant	low_impact	indel	.	2.229	no	.	.
nat1	sg28	1095C>A	no_effect	no_effect	3_prime_UTR_variant	rs15561	C	A	18080651	A	revertant	18223142	A	revertant	low_impact	snv	unknown_function	0.298	no	.	.
nat1	sg29	1105delT	no_effect	no_effect	3_prime_UTR_variant	rs72554613	AT	A	18080660	AT	not_revertant	18223151	AT	not_revertant	low_impact	indel	.	0.162	no	.	.
nat2	sg1	29T>C	I10T	I10T	missense_variant	rs72466456	T	C	18257542	T	not_revertant	18400032	T	not_revertant	moderate_impact	snv	.	24.6	no	.	.
nat2	sg2	70T>A	L24I	L24I	missense_variant	rs45477599	T	A	18257583	T	not_revertant	18400073	T	not_revertant	moderate_impact	snv	unknown_function	23	no	.	.
nat2	sg3	111T>C	F37#	F37#	synonymous_variant	rs72554615	T	C	18257624	T	not_revertant	18400114	T	not_revertant	low_impact	snv	.	9.953	no	.	.
nat2	sg4	152G>T	G51V	G51V	missense_variant	rs72466457	G	T	18257665	G	not_revertant	18400155	G	not_revertant	moderate_impact	snv	.	15.45	no	.	.
nat2	sg5	190C>T	R64W	R64W	missense_variant	rs1805158	C	T	18257703	C	not_revertant	18400193	C	not_revertant	high_impact	snv	decreased_function	22.8	no	.	.
nat2	sg6	191G>A	R64Q	R64Q	missense_variant	rs1801279	G	A	18257704	G	not_revertant	18400194	G	not_revertant	high_impact	snv	decreased_function	22.2	no	.	.
nat2	sg7	203G>A	C68Y	C68Y	missense_variant	rs72466458	G	A	18257716	G	not_revertant	18400206	G	not_revertant	moderate_impact	snv	.	25.2	no	.	.
nat2	sg8	226T>G	Y76D	Y76D	missense_variant	.	T	G	18257739	T	not_revertant	18400229	T	not_revertant	moderate_impact	snv	.	21.9	no	.	.
nat2	sg9	228C>T	Y76#	Y76#	synonymous_variant	rs72466459	C	T	18257741	C	not_revertant	18400231	C	not_revertant	low_impact	snv	.	6.042	no	.	.
nat2	sg10	282C>T	Y94#	Y94#	synonymous_variant	rs1041983	C	T	18257795	C	not_revertant	18400285	C	not_revertant	low_impact	snv	normal_function	0.354	no	.	.
nat2	sg11	308C>T	T103I	T103I	missense_variant	rs749903527	C	T	18257821	C	not_revertant	18400311	C	not_revertant	moderate_impact	snv	.	0.167	no	.	.
nat2	sg12	341T>C	I114T	I114T	missense_variant	rs1801280	T	C	18257854	T	not_revertant	18400344	T	not_revertant	high_impact	snv	decreased_function	15.35	no	.	.
nat2	sg13	345C>T	D115#	D115#	synonymous_variant	rs45532639	C	T	18257858	C	not_revertant	18400348	C	not_revertant	low_impact	snv	.	0.581	no	.	.
nat2	sg14	364G>A	D122N 	D122N 	missense_variant	rs4986996	G	A	18257877	G	not_revertant	18400367	G	not_revertant	moderate_impact	snv	.	23.8	no	.	.
nat2	sg15	403C>G	L135V	L135V	missense_variant	rs12720065   	C	G	18257916	C	not_revertant	18400406	C	not_revertant	moderate_impact	snv	unknown_function	15.68	no	.	.
nat2	sg16	411A>T	L137F	L137F	missense_variant	rs4986997	A	T	18257924	A	not_revertant	18400414	A	not_revertant	moderate_impact	snv	.	22.5	no	.	.
nat2	sg17	434A>C	Q145P	Q145P	missense_variant	rs72554616	A	C	18257947	A	not_revertant	18400437	A	not_revertant	high_impact	snv	decreased_function	23.2	no	.	.
nat2	sg18	458C>T	T153I	T153I	missense_variant	rs72466460	C	T	18257971	C	not_revertant	18400461	C	not_revertant	moderate_impact	snv	unknown_function	4.118	no	.	.
nat2	sg19	472A>C	I158L	I158L	missense_variant	rs139351995	A	C	18257985	A	not_revertant	18400475	A	not_revertant	moderate_impact	snv	.	4.296	no	.	.
nat2	sg20	481C>T	L161#	L161#	synonymous_variant	rs1799929	C	T	18257994	C	not_revertant	18400484	C	not_revertant	low_impact	snv	normal_function	6.492	no	.	.
nat2	sg21	499G>A	E167K	E167K	missense_variant	rs72554617	G	A	18258012	G	not_revertant	18400502	G	not_revertant	high_impact	snv	decreased_function	12.55	no	.	.
nat2	sg22	518A>G	K173R	K173R	missense_variant	rs369500066	A	G	18258031	A	not_revertant	18400521	A	not_revertant	moderate_impact	snv	.	5.286	no	.	.
nat2	sg23	578C>T	T193M	T193M	missense_variant	rs79050330	C	T	18258091	C	not_revertant	18400581	C	not_revertant	moderate_impact	snv	.	23.2	no	.	.
nat2	sg24	590G>A	R197Q	R197Q	missense_variant	rs1799930	G	A	18258103	G	not_revertant	18400593	G	not_revertant	high_impact	snv	decreased_function	23.8	no	.	.
nat2	sg25	600A>G	E200#	E200#	synonymous_variant	rs72466461	A	G	18258113	A	not_revertant	18400603	A	not_revertant	low_impact	snv	unknown_function	3.228	no	.	.
nat2	sg26	609G>T	E203D	E203D	missense_variant	rs45618543	G	T	18258122	G	not_revertant	18400612	G	not_revertant	moderate_impact	snv	unknown_function	9.277	no	.	.
nat2	sg27	622T>C	Y208H	Y208H	missense_variant	rs56387565	T	C	18258135	T	not_revertant	18400625	T	not_revertant	moderate_impact	snv	.	12.01	no	.	.
nat2	sg28	633G>A	T211#	T211#	synonymous_variant	rs1309998351	G	A	18258146	G	not_revertant	18400636	G	not_revertant	low_impact	snv	.	0.066	no	.	.
nat2	sg29	638C>T	P213L	P213L	missense_variant	rs138707146	C	T	18258151	C	not_revertant	18400641	C	not_revertant	moderate_impact	snv	.	17.16	no	.	.
nat2	sg30	665T>G	F222C	F222C	missense_variant	.	T	G	18258178	T	not_revertant	18400668	T	not_revertant	moderate_impact	snv	unknown_function	23.9	no	.	.
nat2	sg31	683C>T	P228L	P228L	missense_variant	rs45518335	C	T	18258196	C	not_revertant	18400686	C	not_revertant	moderate_impact	snv	.	17.42	no	.	.
nat2	sg32	759C>T	V253#	V253#	synonymous_variant	rs56011192	C	T	18258272	C	not_revertant	18400762	C	not_revertant	low_impact	snv	.	0.647	no	.	.
nat2	sg33	766A>G	K256E	K256E	missense_variant	rs55700793	A	G	18258279	A	not_revertant	18400769	A	not_revertant	moderate_impact	snv	.	22.3	no	.	.
nat2	sg34	803A>G	K268R	K268R	missense_variant	rs1208	A	G	18258316	G	revertant	18400806	G	revertant	moderate_impact	snv	normal_function	2.228	no	.	.
nat2	sg35	838G>A	V280M	V280M	missense_variant	rs56393504 	G	A	18258351	G	not_revertant	18400841	G	not_revertant	moderate_impact	snv	.	11.06	no	.	.
nat2	sg36	845A>C 	K282T	K282T	missense_variant	rs56054745	A	C	18258358	A	not_revertant	18400848	A	not_revertant	moderate_impact	snv	normal_function	23.2	no	.	.
nat2	sg37	857G>A	G286E	G286E	missense_variant	rs1799931	G	A	18258370	G	not_revertant	18400860	G	not_revertant	high_impact	snv	decreased_function	0.414	no	.	.
nudt15	sg1	NG_2T>C	M1T	M1T	start_lost	rs769369441	T	C	48611884	T	not_revertant	48037748	T	not_revertant	high_impact	snv	no_function	13.31	yes	.	.
nudt15	sg2	NG_3G>C	M1I	M1I	start_lost	rs941255227	G	C	48611885	G	not_revertant	48037749	G	not_revertant	high_impact	snv	no_function	15.06	yes	.	.
nudt15	sg3	NG_50delGAGTCG	G17_V18del	G17_V18del	inframe_deletion	rs746071566	AGGAGTC	A	48611918	AGGAGTC	not_revertant	48037782	AGGAGTC	not_revertant	high_impact	indel	severely_decreased_function	19.69	no	.	.
nudt15	sg4	NG_55_56insGAGTCG	18_19insGV	18_19insGV	inframe_insertion	rs746071566	A	AGGAGTC	48611918	A	not_revertant	48037782	A	not_revertant	high_impact	indel	severely_decreased_function	19.24	no	.	.
nudt15	sg5	NG_52G>A	V18I	V18I	missense_variant	rs186364861	G	A	48611934	G	not_revertant	48037798	G	not_revertant	high_impact	snv	severely_decreased_function	24.5	no	.	.
nudt15	sg6	NG_80_81insCGGG	frameshift	frameshift	frameshift_variant	rs777311140	C	CGCGG	48611961	G	not_revertant	48037825	C	not_revertant	high_impact	indel	no_function	24.7	yes	.	.
nudt15	sg7	NG_88C>T	L30V	L30V	missense_variant	.	C	T	48611970	C	not_revertant	48037834	C	not_revertant	moderate_impact	snv	unknown_function	24.2	no	.	.
nudt15	sg8	NG_101G>C	R34T	R34T	missense_variant	rs766023281	G	C	48611983	G	not_revertant	48037847	G	not_revertant	high_impact	snv	severely_decreased_function	24.2	no	.	.
nudt15	sg9	NG_103A>G	K35E	K35E	missense_variant	.	A	G	48611985	A	not_revertant	48037849	A	not_revertant	high_impact	snv	severely_decreased_function	25.8	no	.	.
nudt15	sg10	NG_139G>A	G47R	G47R	missense_variant	.	G	A	48612021	G	not_revertant	48037885	G	not_revertant	moderate_impact	snv	unknown_function	27.5	no	.	.
nudt15	sg11	NG_156C>G	F52L	F52L	missense_variant	rs149436418	C	G	48612038	C	not_revertant	48037902	C	not_revertant	moderate_impact	snv	unknown_function	25.4	no	.	.
nudt15	sg12	NG_3236delA	frameshift	frameshift	frameshift_variant	rs1457579126	GA	G	48615113	GA	not_revertant	48040977	GA	not_revertant	high_impact	indel	no_function	33	yes	.	.
nudt15	sg13	NG_3357_3358insG	frameshift	frameshift	frameshift_variant	rs761191455	T	TG	48615239	T	not_revertant	48041103	T	not_revertant	high_impact	indel	no_function	34	yes	.	.
nudt15	sg14	NG_3367G>T	E118X	E118X	stop_gained	rs1368252918	G	T	48615249	G	not_revertant	48041113	G	not_revertant	high_impact	snv	no_function	39	yes	.	.
nudt15	sg15	NG_7973C>T	R139C	R139C	missense_variant	rs116855232	C	T	48619855	C	not_revertant	48045719	C	not_revertant	high_impact	snv	severely_decreased_function	17.44	no	.	.
nudt15	sg16	NG_7974G>A	R139H	R139H	missense_variant	rs147390019	G	A	48619856	G	not_revertant	48045720	G	not_revertant	high_impact	snv	severely_decreased_function	23.3	no	.	.
nudt15	sg17	NG_8025T>A	L156Q	L156Q	missense_variant	rs139551410	T	A	48619907	T	not_revertant	48045771	T	not_revertant	moderate_impact	snv	unknown_function	26	no	.	.
por	sg1	.	no_effect	no_effect	intron_variant	rs239953	T	C	75579490	T	not_revertant	75950172	T	not_revertant	low_impact	snv	.	1.548	no	.	.
por	sg2	143delG	frameshift	frameshift	frameshift_variant	.	AG	A	75583452	AG	not_revertant	75954134	AG	not_revertant	high_impact	indel	no_function	25.3	yes	.	.
por	sg3	147G>C	K49N	K49N	missense_variant	rs56355228	G	C	75583457	G	not_revertant	75954139	G	not_revertant	moderate_impact	snv	unknown_function	22.8	no	.	.
por	sg4	.	E53del	E53del	inframe_deletion	rs72553987	AAAG	A	75583461	AAAG	not_revertant	75954143	AAAG	not_revertant	moderate_impact	indel	.	19.5	no	.	.
por	sg5	.	no_effect	no_effect	intron_variant	rs4728533	T	C	75586536	T	not_revertant	75957218	T	not_revertant	low_impact	snv	.	0.55	no	.	.
por	sg6	304T>C	S102P	S102P	missense_variant	rs782804219	T	C	75608835	T	not_revertant	75979517	T	not_revertant	moderate_impact	snv	unknown_function	25.6	no	.	.
por	sg7	344C>T	A115V	A115V	missense_variant	rs199634961	C	T	75608875	C	not_revertant	75979557	C	not_revertant	high_impact	snv	decreased_function	22.5	no	.	.
por	sg8	424A>G	T142A	T142A	missense_variant	rs1304915832	A	G	75609714	A	not_revertant	75980396	A	not_revertant	high_impact	snv	decreased_function	25.1	no	.	.
por	sg9	458A>G	Q153R	Q153R	missense_variant	.	A	G	75609748	A	not_revertant	75980430	A	not_revertant	high_impact	snv	decreased_function	22.1	no	.	.
por	sg10	490G>A	V164M	V164M	missense_variant	rs200112691	G	A	75609780	G	not_revertant	75980462	G	not_revertant	moderate_impact	snv	unknown_function	2.11	no	.	.
por	sg11	541T>G	Y181D	Y181D	missense_variant	rs72552771	T	G	75610390	T	not_revertant	75981072	T	not_revertant	high_impact	snv	decreased_function	27.4	no	.	.
por	sg12	571G>A	V191M	V191M	missense_variant	rs201513102	G	A	75610420	G	not_revertant	75981102	G	not_revertant	moderate_impact	snv	unknown_function	25.9	no	.	.
por	sg13	571G>C	V191L	V191L	missense_variant	rs201513102	G	C	75610420	G	not_revertant	75981102	G	not_revertant	moderate_impact	snv	unknown_function	22.7	no	.	.
por	sg14	580_581insTACGTGGACAAGC	frameshift	frameshift	frameshift_variant	rs786205878	C	CTACGTGGACAAGC	75610429	C	not_revertant	75981111	C	not_revertant	high_impact	indel	no_function	28.7	yes	.	.
por	sg15	601C>T	Q201X	Q201X	stop_gained	.	C	T	75610450	C	not_revertant	75981132	C	not_revertant	high_impact	snv	decreased_function	37	yes	.	.
por	sg16	683C>T	P228L	P228L	missense_variant	rs17853284	C	T	75610876	C	not_revertant	75981558	C	not_revertant	moderate_impact	snv	.	25	no	.	.
por	sg17	.	splicing_defect	splicing_defect	splice_donor_variant	rs786205099	G	A	75610925	G	not_revertant	75981607	G	not_revertant	high_impact	snv	decreased_function	29.8	yes	.	.
por	sg18	787A>G	M263V	M263V	missense_variant	.	A	G	75611597	A	not_revertant	75982279	A	not_revertant	high_impact	snv	decreased_function	0.71	no	.	.
por	sg19	859G>C	A287P	A287P	missense_variant	rs121912974	G	C	75612866	G	not_revertant	75983548	G	not_revertant	high_impact	snv	decreased_function	28.5	no	.	.
por	sg20	1030G>A	D344N	D344N	missense_variant	rs782424131	G	A	75613138	G	not_revertant	75983820	G	not_revertant	moderate_impact	snv	unknown_function	20.3	no	.	.
por	sg21	1042_1044delGTC	V348del	V348del	inframe_deletion	.	CGTC	C	75613149	CGTC	not_revertant	75983831	CGTC	not_revertant	moderate_impact	indel	.	16.16	no	.	.
por	sg22	1193A>C	E398A	E398A	missense_variant	.	A	C	75614221	A	not_revertant	75984903	A	not_revertant	moderate_impact	snv	unknown_function	21.6	no	.	.
por	sg23	1237G>A	G413S	G413S	missense_variant	rs567904247	G	A	75614265	G	not_revertant	75984947	G	not_revertant	moderate_impact	snv	unknown_function	22.3	no	.	.
por	sg24	1258C>A	L420M	L420M	missense_variant	.	C	A	75614385	C	not_revertant	75985067	C	not_revertant	moderate_impact	snv	unknown_function	20.6	no	.	.
por	sg25	1329_1330insC	frameshift	frameshift	frameshift_variant	rs786205875	C	CC	75614456	C	not_revertant	75985138	C	not_revertant	high_impact	indel	no_function	32	yes	.	.
por	sg26	1339C>A	L447M	L447M	missense_variant	.	C	A	75614466	C	not_revertant	75985148	C	not_revertant	moderate_impact	snv	unknown_function	24	no	.	.
por	sg27	1348_1349insGAGC	frameshift	frameshift	frameshift_variant	.	C	CGAGC	75614475	C	not_revertant	75985157	C	not_revertant	high_impact	indel	no_function	25.4	yes	.	.
por	sg28	1370G>A	R457H	R457H	missense_variant	rs28931608	G	A	75614497	G	not_revertant	75985179	G	not_revertant	high_impact	snv	no_function	28	no	.	.
por	sg29	1375T>C	Y459H	Y459H	missense_variant	.	T	C	75614502	T	not_revertant	75985184	T	not_revertant	high_impact	snv	decreased_function	27.9	no	.	.
por	sg30	1386_1387insATCGCC	462_463insIA	462_463insIA	inframe_insertion	.	C	CATCGCC	75614513	C	not_revertant	75985195	C	not_revertant	moderate_impact	indel	.	22.1	no	.	.
por	sg31	1475T>A	V492E	V492E	missense_variant	rs28931606	T	A	75614973	T	not_revertant	75985655	T	not_revertant	high_impact	snv	decreased_function	27.6	no	.	.
por	sg32	1508C>T	A503V	A503V	missense_variant	rs1057868	C	T	75615006	C	not_revertant	75985688	C	not_revertant	high_impact	snv	decreased_function	13.88	no	.	.
por	sg33	1551_1552insTGCCCATGTTCGTGCGC	frameshift	frameshift	frameshift_variant	.	C	CTGCCCATGTTCGTGCGC	75615049	C	not_revertant	75985731	C	not_revertant	high_impact	indel	no_function	34	yes	.	.
por	sg34	1615G>A	G539R	G539R	missense_variant	rs121912976	G	A	75615113	G	not_revertant	75985795	G	not_revertant	high_impact	snv	decreased_function	24.3	no	.	.
por	sg35	1619_1620insCCTTCAAGGCCACCACGCCTGTCATCATGATGGGCCCCGGCACCGGGGT	frameshift	frameshift	frameshift_variant	.	T	TCCTTCAAGGCCACCACGCCTGTCATCATGATGGGCCCCGGCACCGGGGT	75615117	T	not_revertant	75985799	T	not_revertant	high_impact	indel	no_function	29.5	yes	.	.
por	sg36	1621_1622insC	frameshift	frameshift	frameshift_variant	.	G	GC	75615119	G	not_revertant	75985801	G	not_revertant	high_impact	indel	no_function	35	yes	.	.
por	sg37	1665delG	frameshift	frameshift	frameshift_variant	.	AG	A	75615162	AG	not_revertant	75985844	AG	not_revertant	high_impact	indel	no_function	29.3	yes	.	.
por	sg38	1694T>C	L565P	L565P	missense_variant	rs1312625886	T	C	75615265	T	not_revertant	75985947	T	not_revertant	high_impact	snv	decreased_function	27.7	no	.	.
por	sg39	1698_1699insC	frameshift	frameshift	frameshift_variant	.	C	CC	75615269	C	not_revertant	75985951	C	not_revertant	high_impact	indel	.	34	yes	.	.
por	sg40	1706G>A	C569Y	C569Y	missense_variant	rs28931607	G	A	75615277	G	not_revertant	75985959	G	not_revertant	high_impact	snv	decreased_function	28.7	no	.	.
por	sg41	1730T>C	L577P	L577P	missense_variant	rs56256515	T	C	75615301	T	not_revertant	75985983	T	not_revertant	high_impact	snv	decreased_function	26.8	no	.	.
por	sg42	1733A>G	Y578C	Y578C	missense_variant	rs121912975	A	G	75615304	A	not_revertant	75985986	A	not_revertant	high_impact	snv	decreased_function	27.5	no	.	.
por	sg43	1738G>C	E580Q	E580Q	missense_variant	rs782128221	G	C	75615309	G	not_revertant	75985991	G	not_revertant	high_impact	snv	decreased_function	22.4	no	.	.
por	sg44	1822G>T	V608F	V608F	missense_variant	rs72552772	G	T	75615483	G	not_revertant	75986165	G	not_revertant	high_impact	snv	decreased_function	23.7	no	.	.
por	sg45	1835_1858delTAAAGCAAGACCGAGAGCACCTGT	L612_W620del	L612_W620del	inframe_deletion	rs786205876	CTAAAGCAAGACCGAGAGCACCTGT	C	75615495	CTAAAGCAAGACCGAGAGCACCTGT	not_revertant	75986177	CTAAAGCAAGACCGAGAGCACCTGT	not_revertant	moderate_impact	indel	.	17.75	no	.	.
por	sg46	1846C>T	R616X	R616X	stop_gained	rs781946801	C	T	75615507	C	not_revertant	75986189	C	not_revertant	high_impact	snv	decreased_function	36	yes	.	.
por	sg47	1891G>A	V631I	V631I	missense_variant	rs145782750	G	A	75615552	G	not_revertant	75986234	G	not_revertant	moderate_impact	snv	.	18.72	no	.	.
por	sg48	1937_1939delTCT	F646del	F646del	inframe_deletion	rs781890088	TTCT	T	75615692	TTCT	not_revertant	75986374	TTCT	not_revertant	high_impact	indel	decreased_function	20.1	no	.	.
por	sg49	1975G>A	A659T	A659T	missense_variant	rs373737641	G	A	75615731	G	not_revertant	75986413	G	not_revertant	moderate_impact	snv	unknown_function	1.801	no	.	.
ptgis	sg1	1339G>A	A447T	A447T	missense_variant	rs146531327	C	T	48127584	C	not_revertant	49511047	C	not_revertant	moderate_impact	snv	unknown_function	24.8	no	.	.
ptgis	sg2	1135C>A	R379S	R379S	missense_variant	rs56195291	G	T	48129688	G	not_revertant	49513151	G	not_revertant	moderate_impact	snv	unknown_function	24.2	no	.	.
ptgis	sg3	940G>T	E314X	E314X	stop_gained	rs13306027	C	A	48130848	C	not_revertant	49514311	C	not_revertant	high_impact	snv	unknown_function	35	yes	.	.
ptgis	sg4	354T>A	S118R	S118R	missense_variant	rs5622	A	T	48164401	A	not_revertant	49547864	A	not_revertant	moderate_impact	snv	unknown_function	10.72	no	.	.
ptgis	sg5	113C>T	P38L	P38L	missense_variant	rs1173082660	G	A	48166688	G	not_revertant	49550151	G	not_revertant	moderate_impact	snv	unknown_function	23.3	no	.	.
ptgis	sg6	.	promoter	promoter	5_prime_UTR_variant	rs773006734	C	CGCGGGGCTG	48184654	C	not_revertant	49568117	C	not_revertant	high_impact	indel	increased_function	7.511	no	.	.
ptgis	sg7	.	promoter	promoter	5_prime_UTR_variant	rs773006734	C	CGCGGGGCTGGCGGGGCTG	48184654	C	not_revertant	49568117	C	not_revertant	high_impact	indel	increased_function	7.064	no	.	.
ptgis	sg8	.	promoter	promoter	5_prime_UTR_variant	rs773006734	C	CGCGGGGCTGGCGGGGCTGGCGGGGCTG	48184654	C	not_revertant	49568117	C	not_revertant	moderate_impact	indel	unknown_function	6.605	no	.	.
ptgis	sg9	.	promoter	promoter	5_prime_UTR_variant	rs773006734	C	CGCGGGGCTGGCGGGGCTGGCGGGGCTGGCGGGGCTG	48184654	C	not_revertant	49568117	C	not_revertant	moderate_impact	indel	unknown_function	6.121	no	.	.
ryr1	sg1	103T>C	C35R	C35R	missense_variant	rs193922747	T	C	38931442	T	not_revertant	38440802	T	not_revertant	high_impact	snv	increased_function	27	no	.	.
ryr1	sg2	130C>T	R44C	R44C	missense_variant	rs193922748	C	T	38931469	C	not_revertant	38440829	C	not_revertant	high_impact	snv	increased_function	27.2	no	.	.
ryr1	sg3	487C>T	R163C	R163C	missense_variant	rs118192161	C	T	38934851	C	not_revertant	38444211	C	not_revertant	high_impact	snv	increased_function	25.7	no	.	.
ryr1	sg4	488G>T	R163L	R163L	missense_variant	rs193922753	G	T	38934852	G	not_revertant	38444212	G	not_revertant	high_impact	snv	increased_function	25.6	no	.	.
ryr1	sg5	742G>A	G248R	G248R	missense_variant	rs1801086	G	A	38937350	G	not_revertant	38446710	G	not_revertant	high_impact	snv	increased_function	25.7	no	.	.
ryr1	sg6	742G>C	G248R	G248R	missense_variant	rs1801086	G	C	38937350	G	not_revertant	38446710	G	not_revertant	high_impact	snv	increased_function	25.5	no	.	.
ryr1	sg7	982C>T	R328W	R328W	missense_variant	rs193922762	C	T	38939313	C	not_revertant	38448673	C	not_revertant	high_impact	snv	increased_function	23.9	no	.	.
ryr1	sg8	1021G>A	G341R	G341R	missense_variant	rs121918592	G	A	38939352	G	not_revertant	38448712	G	not_revertant	high_impact	snv	increased_function	26	no	.	.
ryr1	sg9	1021G>C	G341R	G341R	missense_variant	rs121918592	G	C	38939352	G	not_revertant	38448712	G	not_revertant	high_impact	snv	increased_function	25.7	no	.	.
ryr1	sg10	1201C>T	R401C	R401C	missense_variant	rs193922764	C	T	38942482	C	not_revertant	38451842	C	not_revertant	high_impact	snv	increased_function	26.3	no	.	.
ryr1	sg11	1209C>G	I403M	I403M	missense_variant	rs118192116	C	G	38942490	C	not_revertant	38451850	C	not_revertant	high_impact	snv	increased_function	16.56	no	.	.
ryr1	sg12	1565A>C	Y522S	Y522S	missense_variant	rs118192162	A	C	38945999	A	not_revertant	38455359	A	not_revertant	high_impact	snv	increased_function	26.1	no	.	.
ryr1	sg13	1589G>A	R530H	R530H	missense_variant	rs111888148	G	A	38946103	G	not_revertant	38455463	G	not_revertant	high_impact	snv	increased_function	27.5	no	.	.
ryr1	sg14	1597C>T	R533C	R533C	missense_variant	rs193922768	C	T	38946111	C	not_revertant	38455471	C	not_revertant	high_impact	snv	increased_function	27.7	no	.	.
ryr1	sg15	1598G>A	R533H	R533H	missense_variant	rs144336148	G	A	38946112	G	not_revertant	38455472	G	not_revertant	high_impact	snv	increased_function	24.2	no	.	.
ryr1	sg16	1654C>T	R552W	R552W	missense_variant	rs193922770	C	T	38946168	C	not_revertant	38455528	C	not_revertant	high_impact	snv	increased_function	24.9	no	.	.
ryr1	sg17	1840C>T	R614C	R614C	missense_variant	rs118192172	C	T	38948185	C	not_revertant	38457545	C	not_revertant	high_impact	snv	increased_function	28.9	no	.	.
ryr1	sg18	1841G>T	R614L	R614L	missense_variant	rs193922772	G	T	38948186	G	not_revertant	38457546	G	not_revertant	high_impact	snv	increased_function	28.4	no	.	.
ryr1	sg19	6487C>T	R2163C	R2163C	missense_variant	rs118192175	C	T	38985204	C	not_revertant	38494564	C	not_revertant	high_impact	snv	increased_function	28.9	no	.	.
ryr1	sg20	6488G>A	R2163H	R2163H	missense_variant	rs118192163	G	A	38985205	G	not_revertant	38494565	G	not_revertant	high_impact	snv	increased_function	26.9	no	.	.
ryr1	sg21	6502G>A	V2168M	V2168M	missense_variant	rs118192176	G	A	38985219	G	not_revertant	38494579	G	not_revertant	high_impact	snv	increased_function	25.6	no	.	.
ryr1	sg22	6617C>G	T2206R	T2206R	missense_variant	rs118192177	C	G	38986923	C	not_revertant	38496283	C	not_revertant	high_impact	snv	increased_function	25.9	no	.	.
ryr1	sg23	6617C>T	T2206M	T2206M	missense_variant	rs118192177	C	T	38986923	C	not_revertant	38496283	C	not_revertant	high_impact	snv	increased_function	26.7	no	.	.
ryr1	sg24	7007G>A	R2336H	R2336H	missense_variant	rs112563513	G	A	38989863	G	not_revertant	38499223	G	not_revertant	high_impact	snv	increased_function	25.4	no	.	.
ryr1	sg25	7039_7041delGAG	E2348del	E2348del	inframe_insertion	rs121918596	GGAG	G	38990285	GGAG	not_revertant	38499645	GGAG	not_revertant	high_impact	indel	increased_function	21.3	no	.	.
ryr1	sg26	7048G>A	A2350T	A2350T	missense_variant	rs193922802	G	A	38990295	G	not_revertant	38499655	G	not_revertant	high_impact	snv	increased_function	25.4	no	.	.
ryr1	sg27	7063C>T	R2355W	R2355W	missense_variant	rs193922803	C	T	38990310	C	not_revertant	38499670	C	not_revertant	high_impact	snv	increased_function	28.5	no	.	.
ryr1	sg28	7124G>C	G2375A	G2375A	missense_variant	rs193922807	G	C	38990371	G	not_revertant	38499731	G	not_revertant	high_impact	snv	increased_function	23.3	no	.	.
ryr1	sg29	7282G>A	A2428T	A2428T	missense_variant	rs193922809	G	A	38990615	G	not_revertant	38499975	G	not_revertant	high_impact	snv	increased_function	23.4	no	.	.
ryr1	sg30	7300G>A	G2434R	G2434R	missense_variant	rs121918593	G	A	38990633	G	not_revertant	38499993	G	not_revertant	high_impact	snv	increased_function	24.7	no	.	.
ryr1	sg31	7304G>A	R2435H	R2435H	missense_variant	rs28933396	G	A	38990637	G	not_revertant	38499997	G	not_revertant	high_impact	snv	increased_function	25.7	no	.	.
ryr1	sg32	7354C>T	R2452W	R2452W	missense_variant	rs118192124	C	T	38991276	C	not_revertant	38500636	C	not_revertant	high_impact	snv	increased_function	24.6	no	.	.
ryr1	sg33	7360C>T	R2454C	R2454C	missense_variant	rs193922816	C	T	38991282	C	not_revertant	38500642	C	not_revertant	high_impact	snv	increased_function	28.7	no	.	.
ryr1	sg34	7361G>A	R2454H	R2454H	missense_variant	rs118192122	G	A	38991283	G	not_revertant	38500643	G	not_revertant	high_impact	snv	increased_function	29.2	no	.	.
ryr1	sg35	7372C>T	R2458C	R2458C	missense_variant	rs28933397	C	T	38991294	C	not_revertant	38500654	C	not_revertant	high_impact	snv	increased_function	31	no	.	.
ryr1	sg36	7373G>A	R2458H	R2458H	missense_variant	rs121918594	G	A	38991295	G	not_revertant	38500655	G	not_revertant	high_impact	snv	increased_function	29.8	no	.	.
ryr1	sg37	7522C>G	R2508G	R2508G	missense_variant	rs118192178	C	G	38991538	C	not_revertant	38500898	C	not_revertant	high_impact	snv	increased_function	24.5	no	.	.
ryr1	sg38	7522C>T	R2508C	R2508C	missense_variant	rs118192178	C	T	38991538	C	not_revertant	38500898	C	not_revertant	high_impact	snv	increased_function	25.7	no	.	.
ryr1	sg39	7523G>A	R2508H	R2508H	missense_variant	rs193922818	G	A	38991539	G	not_revertant	38500899	G	not_revertant	high_impact	snv	increased_function	25.7	no	.	.
ryr1	sg40	9310G>A	E3104K	E3104K	missense_variant	rs193922832	G	A	39002961	G	not_revertant	38512321	G	not_revertant	high_impact	snv	increased_function	26	no	.	.
ryr1	sg41	.	K3495del	K3495del	inframe_deletion	rs750515732	CAAG	C	39015998	CAAG	not_revertant	38525358	CAAG	not_revertant	moderate_impact	indel	.	18.99	no	.	.
ryr1	sg42	11969G>T	G3990V	G3990V	missense_variant	rs193922843	G	T	39034472	G	not_revertant	38543832	G	not_revertant	high_impact	snv	increased_function	32	no	.	.
ryr1	sg43	14387A>G	Y4796C	Y4796C	missense_variant	rs118192167	A	G	39070644	A	not_revertant	38580004	A	not_revertant	high_impact	snv	increased_function	31	no	.	.
ryr1	sg44	14477C>T	T4826I	T4826I	missense_variant	rs121918595	C	T	39070734	C	not_revertant	38580094	C	not_revertant	high_impact	snv	increased_function	28	no	.	.
ryr1	sg45	14497C>T	H4833Y	H4833Y	missense_variant	rs193922876	C	T	39070754	C	not_revertant	38580114	C	not_revertant	high_impact	snv	increased_function	29.1	no	.	.
ryr1	sg46	14512C>G	L4838V	L4838V	missense_variant	rs193922878	C	G	39071010	C	not_revertant	38580370	C	not_revertant	high_impact	snv	increased_function	28.4	no	.	.
ryr1	sg47	14545G>A	V4849I	V4849I	missense_variant	rs118192168	G	A	39071043	G	not_revertant	38580403	G	not_revertant	high_impact	snv	increased_function	24.8	no	.	.
ryr1	sg48	14582G>A	R4861H	R4861H	missense_variant	rs63749869	G	A	39071080	G	not_revertant	38580440	G	not_revertant	high_impact	snv	unknown_function	33	no	.	.
ryr1	sg49	14693T>C	I4898T	I4898T	missense_variant	rs118192170	T	C	39075629	T	not_revertant	38584989	T	not_revertant	high_impact	snv	decreased_function	29	no	.	.
slc15a2	sg1	.	no_effect	no_effect	intron_variant	rs3792596	C	T	121629158	C	not_revertant	121910311	C	not_revertant	low_impact	snv	.	5.358	no	.	.
slc15a2	sg2	.	no_effect	no_effect	intron_variant	rs2332052	A	G	121629318	A	not_revertant	121910471	A	not_revertant	low_impact	snv	.	4.921	no	.	.
slc15a2	sg3	.	no_effect	no_effect	intron_variant	rs2332051	G	A	121629322	G	not_revertant	121910475	G	not_revertant	low_impact	snv	.	3.229	no	.	.
slc15a2	sg4	.	no_effect	no_effect	intron_variant	rs2877568	C	T	121629634	C	not_revertant	121910787	C	not_revertant	low_impact	snv	.	7.196	no	.	.
slc15a2	sg5	.	no_effect	no_effect	intron_variant	rs9289183	T	C	121629928	T	not_revertant	121911081	T	not_revertant	low_impact	snv	.	5.41	no	.	.
slc15a2	sg6	.	no_effect	no_effect	intron_variant	rs6803757	T	C	121630194	T	not_revertant	121911347	T	not_revertant	low_impact	snv	.	6.9	no	.	.
slc15a2	sg7	.	no_effect	no_effect	intron_variant	rs6438687	A	G	121630328	A	not_revertant	121911481	A	not_revertant	low_impact	snv	.	5.13	no	.	.
slc15a2	sg8	.	splicing_defect	splicing_defect	splice_donor_variant	rs1480057696	G	A	121630514	G	not_revertant	121911667	G	not_revertant	high_impact	snv	unknown_function	34	yes	.	.
slc15a2	sg9	1048C>T	L350F	L350F	missense_variant	rs2257212	C	T	121643804	C	not_revertant	121924957	C	not_revertant	moderate_impact	snv	.	15.53	no	.	.
slc15a2	sg10	1225C>T	P409S	P409S	missense_variant	rs1143671	C	T	121647286	C	not_revertant	121928439	C	not_revertant	moderate_impact	snv	.	15.92	no	.	.
slc15a2	sg11	1526G>A	R509K	R509K	missense_variant	rs1143672	G	A	121648168	G	not_revertant	121929321	G	not_revertant	moderate_impact	snv	.	7.63	no	.	.
slc22a2	sg1	.	E524K	E524K	missense_variant	rs769487079	C	T	160645768	C	not_revertant	160224736	C	not_revertant	moderate_impact	snv	.	28.2	no	.	.
slc22a2	sg2	1506A>G	V502#	V502#	synonymous_variant	rs316003	T	C	160645832	C	revertant	160224800	C	revertant	low_impact	snv	unknown_function	0.617	no	.	.
slc22a2	sg3	.	no_effect	no_effect	intron_variant	rs3219197	C	CT	160645921	C	not_revertant	160224889	C	not_revertant	low_impact	indel	.	0.558	no	.	.
slc22a2	sg4	.	no_effect	no_effect	intron_variant	rs316004	T	G	160646173	T	not_revertant	160225141	T	not_revertant	low_impact	snv	.	4.167	no	.	.
slc22a2	sg5	1294A>C	K432Q	K432Q	missense_variant	rs8177517	T	G	160663420	T	not_revertant	160242388	T	not_revertant	moderate_impact	snv	unknown_function	21.6	no	.	.
slc22a2	sg6	1280-35T>C	no_effect	no_effect	intron_variant	rs8177518	A	G	160663469	A	not_revertant	160242437	A	not_revertant	low_impact	snv	unknown_function	1.454	no	.	.
slc22a2	sg7	1198C>T	R400C	R400C	missense_variant	rs8177516	G	A	160664685	G	not_revertant	160243653	G	not_revertant	moderate_impact	snv	unknown_function	28.6	no	.	.
slc22a2	sg8	808G>T	A270S	A270S	missense_variant	rs316019	C	A	160670282	A	revertant	160249250	A	revertant	moderate_impact	snv	unknown_function	9.24	no	.	.
slc22a2	sg9	669C>T	I223#	I223#	synonymous_variant	rs8177510	G	A	160671584	G	not_revertant	160250552	G	not_revertant	low_impact	snv	unknown_function	12.06	no	.	.
slc22a2	sg10	602C>T	T201M	T201M	missense_variant	rs145450955	G	A	160671651	G	not_revertant	160250619	G	not_revertant	moderate_impact	snv	.	15.39	no	.	.
slc22a2	sg11	596C>T	T199I	T199I	missense_variant	rs201919874	G	A	160671657	G	not_revertant	160250625	G	not_revertant	moderate_impact	snv	.	15.68	no	.	.
slc22a2	sg12	493A>G	M165V	M165V	missense_variant	rs8177508	T	C	160677671	T	not_revertant	160256639	T	not_revertant	moderate_impact	snv	.	0.001	no	.	.
slc22a2	sg13	481T>C	F161L	F161L	missense_variant	rs8177509	A	G	160677683	A	not_revertant	160256651	A	not_revertant	moderate_impact	snv	unknown_function	16.65	no	.	.
slc22a2	sg14	390G>T	T130#	T130#	synonymous_variant	rs624249	C	A	160679400	C	not_revertant	160258368	C	not_revertant	low_impact	snv	unknown_function	9.868	no	.	.
slc22a2	sg15	160C>T	P54S	P54S	missense_variant	rs8177504	G	A	160679630	G	not_revertant	160258598	G	not_revertant	moderate_impact	snv	.	22.7	no	.	.
slco1b1	sg1	4195G>A	no_effect	no_effect	upstream_gene_variant	rs4149015	G	A	21283322	G	not_revertant	21130388	G	not_revertant	low_impact	snv	.	0.546	no	.	.
slco1b1	sg2	46541C>T	R57W	R57W	missense_variant	rs139257324	C	T	21325668	C	not_revertant	21172734	C	not_revertant	moderate_impact	snv	.	25.3	no	.	.
slco1b1	sg3	46583G>A	G71R	G71R	missense_variant	rs373327528	G	A	21325710	G	not_revertant	21172776	G	not_revertant	high_impact	snv	decreased_function	26.3	no	.	.
slco1b1	sg4	46589T>C	F73L	F73L	missense_variant	rs56101265	T	C	21325716	T	not_revertant	21172782	T	not_revertant	high_impact	snv	decreased_function	26.1	no	.	.
slco1b1	sg5	48402T>C	V82A	V82A	missense_variant	rs56061388	T	C	21327529	T	not_revertant	21174595	T	not_revertant	moderate_impact	snv	.	18.6	no	.	.
slco1b1	sg6	50611A>G	N130D	N130D	missense_variant	rs2306283	A	G	21329738	A	not_revertant	21176804	A	not_revertant	moderate_impact	snv	normal_function	2.167	no	.	.
slco1b1	sg7	50634G>A	S137#	S137#	synonymous_variant	rs11045818	G	A	21329761	G	not_revertant	21176827	G	not_revertant	low_impact	snv	.	1.492	no	.	.
slco1b1	sg8	50675A>G	N151S	N151S	missense_variant	rs2306282	A	G	21329802	A	not_revertant	21176868	A	not_revertant	moderate_impact	snv	unknown_function	7.703	no	.	.
slco1b1	sg9	50686C>A	P155T	P155T	missense_variant	rs11045819	C	A	21329813	C	not_revertant	21176879	C	not_revertant	moderate_impact	snv	unknown_function	3.412	no	.	.
slco1b1	sg10	50690A>G	E156G	E156G	missense_variant	rs72559745	A	G	21329817	A	not_revertant	21176883	A	not_revertant	moderate_impact	snv	.	14.5	no	.	.
slco1b1	sg11	50705G>T	splicing_defect	splicing_defect	splice_donor_variant	rs77271279	G	T	21329832	G	not_revertant	21176898	G	not_revertant	high_impact	snv	unknown_function	24.6	yes	.	.
slco1b1	sg12	52422T>C	V174A	V174A	missense_variant	rs4149056	T	C	21331549	T	not_revertant	21178615	T	not_revertant	high_impact	snv	decreased_function	22.1	no	.	.
slco1b1	sg13	52472T>C	L191#	L191#	synonymous_variant	rs4149057	T	C	21331599	T	not_revertant	21178665	T	not_revertant	low_impact	snv	.	5.118	no	.	.
slco1b1	sg14	52479T>G	L193R	L193R	missense_variant	rs72559746	T	G	21331606	T	not_revertant	21178672	T	not_revertant	moderate_impact	snv	.	23.6	no	.	.
slco1b1	sg15	52498C>T	F199#	F199#	synonymous_variant	rs2291075	C	T	21331625	C	not_revertant	21178691	C	not_revertant	low_impact	snv	.	13.67	no	.	.
slco1b1	sg16	52764A>G	I222V	I222V	missense_variant	rs79135870	A	G	21331891	A	not_revertant	21178957	A	not_revertant	moderate_impact	snv	.	10.08	no	.	.
slco1b1	sg17	70758A>G	I245V	I245V	missense_variant	rs11045852	A	G	21349885	A	not_revertant	21196951	A	not_revertant	moderate_impact	snv	.	0.805	no	.	.
slco1b1	sg18	70782C>T	R253X	R253X	stop_gained	rs183501729	C	T	21349909	C	not_revertant	21196975	C	not_revertant	high_impact	snv	unknown_function	36	yes	.	.
slco1b1	sg19	70783G>A	R253Q	R253Q	missense_variant	rs11045853	G	A	21349910	G	not_revertant	21196976	G	not_revertant	moderate_impact	snv	.	23.2	no	.	.
slco1b1	sg20	74402T>C	I353T	I353T	missense_variant	rs55901008	T	C	21353529	T	not_revertant	21200595	T	not_revertant	high_impact	snv	decreased_function	22	no	.	.
slco1b1	sg21	76360T>G	F400V	F400V	missense_variant	rs1228465562	T	G	21355487	T	not_revertant	21202553	T	not_revertant	moderate_impact	snv	unknown_function	22.1	no	.	.
slco1b1	sg22	76362C>G	F400L	F400L	missense_variant	rs59113707	C	G	21355489	C	not_revertant	21202555	C	not_revertant	moderate_impact	snv	.	10.85	no	.	.
slco1b1	sg23	76456A>G	N432D	N432D	missense_variant	rs56387224	A	G	21355583	A	not_revertant	21202649	A	not_revertant	moderate_impact	snv	unknown_function	16.55	no	.	.
slco1b1	sg24	76471G>A	G437R	G437R	missense_variant	rs142965323	G	A	21355598	G	not_revertant	21202664	G	not_revertant	moderate_impact	snv	unknown_function	24.4	no	.	.
slco1b1	sg25	79728A>G	D462G	D462G	missense_variant	rs72559748	A	G	21358855	A	not_revertant	21205921	A	not_revertant	moderate_impact	snv	unknown_function	22.4	no	.	.
slco1b1	sg26	79806G>C	G488A	G488A	missense_variant	rs59502379	G	C	21358933	G	not_revertant	21205999	G	not_revertant	high_impact	snv	decreased_function	23.5	no	.	.
slco1b1	sg27	.	R580X	R580X	stop_gained	rs71581941	C	T	21375289	C	not_revertant	21222355	C	not_revertant	high_impact	snv	unknown_function	42	yes	.	.
slco1b1	sg28	112849A>C	L643F	L643F	missense_variant	rs34671512	A	C	21391976	A	not_revertant	21239042	A	not_revertant	moderate_impact	snv	unknown_function	4.293	no	.	.
slco1b1	sg29	112884A>G	D655G	D655G	missense_variant	rs56199088	A	G	21392011	A	not_revertant	21239077	A	not_revertant	high_impact	snv	decreased_function	14.3	no	.	.
slco1b1	sg30	112920A>G	E667G	E667G	missense_variant	rs55737008	A	G	21392047	A	not_revertant	21239113	A	not_revertant	moderate_impact	snv	unknown_function	22.2	no	.	.
slco1b1	sg31	112952C>T	H678Y	H678Y	missense_variant	rs200995543	C	T	21392079	C	not_revertant	21239145	C	not_revertant	moderate_impact	snv	unknown_function	6.166	no	.	.
slco1b1	sg32	112965C>T	S682F	S682F	missense_variant	rs140790673	C	T	21392092	C	not_revertant	21239158	C	not_revertant	moderate_impact	snv	.	14.68	no	.	.
slco1b3	sg1	IVS4+76G>A	no_effect	no_effect	intron_variant	rs4149118	G	A	21011581	G	not_revertant	20858647	G	not_revertant	low_impact	snv	.	6.681	no	.	.
slco1b3	sg2	.	M233I	M233I	missense_variant	rs7311358	G	A	21015760	G	not_revertant	20862826	G	not_revertant	high_impact	snv	decreased_function	13.54	no	.	.
slco1b3	sg3	IVS12-5676A>G	no_effect	no_effect	intron_variant	rs11045585	A	G	21045694	A	not_revertant	20892760	A	not_revertant	low_impact	snv	.	6.966	no	.	.
slco1b3	sg4	347_348insA	no_effect	no_effect	3_prime_UTR_variant	rs397689574	T	TA	21069528	T	not_revertant	20916594	T	not_revertant	low_impact	indel	.	0.286	no	.	.
slco2b1	sg1	6_14delCACAGAAAA	E4_T6del	E4_T6del	inframe_deletion	rs60113013	GCACAGAAAA	G	74873754	GCACAGAAAA	not_revertant	75162709	GCACAGAAAA	not_revertant	moderate_impact	indel	unknown_function	14.78	no	.	.
slco2b1	sg2	1391C>T	S464F	S464F	missense_variant	rs2306168	C	T	74907582	C	not_revertant	75196537	C	not_revertant	moderate_impact	snv	unknown_function	13.41	no	.	.
sult1a1	sg1	874C>T	R292C	R292C	missense_variant	rs745498975	G	A	28617156	G	not_revertant	28605835	G	not_revertant	moderate_impact	snv	.	22.2	no	.	.
sult1a1	sg2	679A>C	T227P	T227P	missense_variant	rs552524124	T	G	28617473	T	not_revertant	28606152	T	not_revertant	moderate_impact	snv	.	22.3	no	.	.
sult1a1	sg3	667A>G	M223V	M223V	missense_variant	rs1801030	T	C	28617485	C	revertant	28606164	C	revertant	moderate_impact	snv	normal_function	15.26	no	.	.
sult1a1	sg4	645G>A	L215#	L215#	synonymous_variant	rs41278160	C	T	28617507	C	not_revertant	28606186	C	not_revertant	low_impact	snv	.	8.42	no	.	.
sult1a1	sg5	638G>A	R213H	R213H	missense_variant	rs9282861	C	T	28617514	C	not_revertant	28606193	C	not_revertant	high_impact	snv	decreased_function	22.6	no	.	.
sult1a1	sg6	600G>C	P200#	P200#	synonymous_variant	rs3176926	C	G	28617552	C	not_revertant	28606231	C	not_revertant	low_impact	snv	.	2.099	no	.	.
sult1a1	sg7	595A>T	N199Y	N199Y	missense_variant	rs754074031	T	A	28617557	T	not_revertant	28606236	T	not_revertant	moderate_impact	snv	.	17.88	no	.	.
sult1a1	sg8	.	no_effect	no_effect	intron_variant	rs376487988	A	T	28618469	A	not_revertant	28607148	A	not_revertant	low_impact	snv	.	0.881	no	.	.
sult1a1	sg9	.	no_effect	no_effect	intron_variant	rs11648192	C	T	28618708	C	not_revertant	28607387	C	not_revertant	low_impact	snv	.	2.7	no	.	.
sult1a1	sg10	.	no_effect	no_effect	intron_variant	rs145414314	TG	T	28618893	TG	not_revertant	28607572	TG	not_revertant	low_impact	indel	.	0.712	no	.	.
sult1a1	sg11	.	no_effect	no_effect	intron_variant	rs56326379	C	T	28619241	C	not_revertant	28607920	C	not_revertant	low_impact	snv	.	2.478	no	.	.
sult1a1	sg12	299C>T	P100L	P100L	missense_variant	rs142537541	G	A	28619685	G	not_revertant	28608364	G	not_revertant	moderate_impact	snv	.	16.73	no	.	.
sult1a1	sg13	298C>T	P100S	P100S	missense_variant	rs762905843	G	A	28619686	G	not_revertant	28608365	G	not_revertant	moderate_impact	snv	.	14.22	no	.	.
sult1a1	sg14	230A>C	M77R	M77R	missense_variant	.	A	C	28619843	A	not_revertant	28608522	A	not_revertant	moderate_impact	snv	.	10.84	no	.	.
sult1a1	sg15	162A>G	V54#	V54#	synonymous_variant	rs1126447	T	C	28619911	T	not_revertant	28608590	T	not_revertant	low_impact	snv	.	6.331	no	.	.
sult1a1	sg16	153T>C	T51#	T51#	synonymous_variant	rs1126446	A	G	28619920	A	not_revertant	28608599	A	not_revertant	low_impact	snv	.	5.397	no	.	.
sult1a1	sg17	.	no_effect	no_effect	intron_variant	rs12924616	T	C	28620025	T	not_revertant	28608704	T	not_revertant	low_impact	snv	.	12.15	no	.	.
sult1a1	sg18	132C>T	S44#	S44#	synonymous_variant	.	G	A	28620045	G	not_revertant	28608724	G	not_revertant	low_impact	snv	.	14.59	no	.	.
sult1a1	sg19	57G>A	P19#	P19#	synonymous_variant	.	C	T	28620120	C	not_revertant	28608799	C	not_revertant	low_impact	snv	.	3.004	no	.	.
sult1a1	sg20	.	no_effect	no_effect	intron_variant	rs4149383	G	A	28620320	G	not_revertant	28608999	G	not_revertant	low_impact	snv	.	7.921	no	.	.
sult1a1	sg21	.	no_effect	no_effect	intron_variant	rs3760091	C	G	28620800	C	not_revertant	28609479	C	not_revertant	low_impact	snv	.	0.018	no	.	.
tbxas1	sg1	182G>A	R61H	R61H	missense_variant	rs6138	G	A	139572123	G	not_revertant	139872324	G	not_revertant	moderate_impact	snv	unknown_function	15.22	no	.	.
tbxas1	sg2	483C>A	D161E	D161E	missense_variant	rs5768	C	A	139653196	A	revertant	139953397	C	not_revertant	moderate_impact	snv	unknown_function	11.05	no	.	.
tbxas1	sg3	737A>G	N246S	N246S	missense_variant	rs55856189	A	G	139657478	A	not_revertant	139957679	A	not_revertant	moderate_impact	snv	unknown_function	23	no	.	.
tbxas1	sg4	1069C>G	L357V	L357V	missense_variant	rs4529	C	G	139661964	C	not_revertant	139962165	C	not_revertant	high_impact	snv	decreased_function	23.3	no	.	.
tbxas1	sg5	1249C>G	Q417E	Q417E	missense_variant	rs4528	C	G	139715542	C	not_revertant	140015742	C	not_revertant	moderate_impact	snv	normal_function	10.62	no	.	.
tbxas1	sg6	1348G>A	E450K	E450K	missense_variant	rs8192868	G	A	139715641	G	not_revertant	140015841	G	not_revertant	moderate_impact	snv	normal_function	22.6	no	.	.
tbxas1	sg7	1352C>A	T451N	T451N	missense_variant	rs5763	C	A	139715645	C	not_revertant	140015845	C	not_revertant	high_impact	snv	decreased_function	9.302	no	.	.
tbxas1	sg8	1397G>A	R466Q	R466Q	missense_variant	rs41311778	G	A	139717500	G	not_revertant	140017700	G	not_revertant	moderate_impact	snv	unknown_function	8.487	no	.	.
tpmt	sg1	719A>G	Y240C	Y240C	missense_variant	rs1142345	T	C	18130918	T	not_revertant	18130687	T	not_revertant	high_impact	snv	no_function	28.7	no	.	.
tpmt	sg2	719A>C	Y240S	Y240S	missense_variant	rs1142345	T	G	18130918	T	not_revertant	18130687	T	not_revertant	high_impact	snv	no_function	28	no	.	.
tpmt	sg3	712A>G	K238E	K238E	missense_variant	rs150900439	T	C	18130925	T	not_revertant	18130694	T	not_revertant	moderate_impact	snv	unknown_function	20.7	no	.	.
tpmt	sg4	681T>G	H227Q	H227Q	missense_variant	rs72552736	A	C	18130956	A	not_revertant	18130725	A	not_revertant	moderate_impact	snv	unknown_function	15.68	no	.	.
tpmt	sg5	677G>A	R226Q	R226Q	missense_variant	rs139392616	C	T	18130960	C	not_revertant	18130729	C	not_revertant	moderate_impact	snv	unknown_function	22.6	no	.	.
tpmt	sg6	648T>A	C216X	C216X	stop_gained	rs398122996	A	T	18130989	A	not_revertant	18130758	A	not_revertant	high_impact	snv	unknown_function	35	yes	.	.
tpmt	sg7	644G>A	R215H	R215H	missense_variant	rs56161402	C	T	18130993	C	not_revertant	18130762	C	not_revertant	moderate_impact	snv	unknown_function	6.362	no	.	.
tpmt	sg8	634T>C	C212R	C212R	missense_variant	rs377085266	A	G	18131003	A	not_revertant	18130772	A	not_revertant	moderate_impact	snv	unknown_function	23.4	no	.	.
tpmt	sg9	626-1G>A	splicing_defect	splicing_defect	splice_acceptor_variant	rs1800584	C	T	18131012	C	not_revertant	18130781	C	not_revertant	high_impact	snv	no_function	26.1	yes	.	.
tpmt	sg10	622T>C	F208L	F208L	missense_variant	rs72556347	A	G	18132367	A	not_revertant	18132136	A	not_revertant	moderate_impact	snv	unknown_function	22.6	no	.	.
tpmt	sg11	611T>C	I204T	I204T	missense_variant	rs79901429	A	G	18132378	A	not_revertant	18132147	A	not_revertant	moderate_impact	snv	unknown_function	23.4	no	.	.
tpmt	sg12	595G>A	V199I	V199I	missense_variant	.	C	T	18132394	C	not_revertant	18132163	C	not_revertant	moderate_impact	snv	unknown_function	24.7	no	.	.
tpmt	sg13	539A>T	Y180F	Y180F	missense_variant	rs75543815	T	A	18134076	T	not_revertant	18133845	T	not_revertant	moderate_impact	snv	unknown_function	23	no	.	.
tpmt	sg14	537G>T	Q179H	Q179H	missense_variant	rs6921269	C	A	18134078	C	not_revertant	18133847	C	not_revertant	moderate_impact	snv	unknown_function	0.055	no	.	.
tpmt	sg15	514T>C	S172P	S172P	missense_variant	rs772832951	A	G	18134101	A	not_revertant	18133870	A	not_revertant	moderate_impact	snv	unknown_function	22.5	no	.	.
tpmt	sg16	500C>G	A167G	A167G	missense_variant	rs74423290	G	C	18134115	G	not_revertant	18133884	G	not_revertant	high_impact	snv	no_function	13.71	no	.	.
tpmt	sg17	495-1G>A	splicing_defect	splicing_defect	splice_acceptor_variant	rs9333570	C	T	18134121	C	not_revertant	18133890	C	not_revertant	high_impact	snv	no_function	25.1	yes	.	.
tpmt	sg18	488G>C	R163P	R163P	missense_variant	rs144041067	C	G	18139200	C	not_revertant	18138969	C	not_revertant	moderate_impact	snv	unknown_function	26.1	no	.	.
tpmt	sg19	488G>A	R163H	R163H	missense_variant	rs144041067	C	T	18139200	C	not_revertant	18138969	C	not_revertant	moderate_impact	snv	unknown_function	25.4	no	.	.
tpmt	sg20	487C>T	R163C	R163C	missense_variant	rs112339338	G	A	18139201	G	not_revertant	18138970	G	not_revertant	high_impact	snv	unknown_function	32	no	.	.
tpmt	sg21	460G>A	A154T	A154T	missense_variant	rs1800460	C	T	18139228	C	not_revertant	18138997	C	not_revertant	high_impact	snv	no_function	23.4	no	.	.
tpmt	sg22	430G>C	G144R	G144R	missense_variant	rs72552737	C	G	18139258	C	not_revertant	18139027	C	not_revertant	high_impact	snv	unknown_function	30	no	.	.
tpmt	sg23	395G>A	C132Y	C132Y	missense_variant	rs72552738	C	T	18139920	C	not_revertant	18139689	C	not_revertant	high_impact	snv	no_function	23.3	no	.	.
tpmt	sg24	374C>T	S125L	S125L	missense_variant	rs200220210	G	A	18139941	G	not_revertant	18139710	G	not_revertant	moderate_impact	snv	unknown_function	23.9	no	.	.
tpmt	sg25	365A>C	K122T	K122T	missense_variant	.	T	G	18143828	T	not_revertant	18143597	T	not_revertant	high_impact	snv	unknown_function	32	no	.	.
tpmt	sg26	356A>C	K119T	K119T	missense_variant	rs151149760	T	G	18143837	T	not_revertant	18143606	T	not_revertant	moderate_impact	snv	unknown_function	24.3	no	.	.
tpmt	sg27	349G>C	G117R	G117R	missense_variant	.	C	G	18143844	C	not_revertant	18143613	C	not_revertant	moderate_impact	snv	unknown_function	26.1	no	.	.
tpmt	sg28	340G>A	E114K	E114K	missense_variant	rs115106679	C	T	18143853	C	not_revertant	18143622	C	not_revertant	moderate_impact	snv	unknown_function	23.4	no	.	.
tpmt	sg29	319T>G	Y107D	Y107D	missense_variant	.	A	C	18143874	A	not_revertant	18143643	A	not_revertant	moderate_impact	snv	unknown_function	26.4	no	.	.
tpmt	sg30	244C>T	R82W	R82W	missense_variant	rs111901354	G	A	18143949	G	not_revertant	18143718	G	not_revertant	moderate_impact	snv	unknown_function	24.3	no	.	.
tpmt	sg31	238G>C	A80P	A80P	missense_variant	rs1800462	C	G	18143955	C	not_revertant	18143724	C	not_revertant	high_impact	snv	no_function	26.1	no	.	.
tpmt	sg32	218C>T	A73V	A73V	missense_variant	rs281874771	G	A	18148069	G	not_revertant	18147838	G	not_revertant	moderate_impact	snv	unknown_function	28.5	no	.	.
tpmt	sg33	211G>A	G71R	G71R	missense_variant	rs777686348	C	T	18148076	C	not_revertant	18147845	C	not_revertant	moderate_impact	snv	unknown_function	26.7	no	.	.
tpmt	sg34	205C>G	L69V	L69V	missense_variant	rs200591577	G	C	18148082	G	not_revertant	18147851	G	not_revertant	moderate_impact	snv	unknown_function	24.7	no	.	.
tpmt	sg35	200T>C	F67S	F67S	missense_variant	.	A	G	18148087	A	not_revertant	18147856	A	not_revertant	moderate_impact	snv	unknown_function	26.3	no	.	.
tpmt	sg36	146T>C	L49S	L49S	missense_variant	rs72552740	A	G	18148141	A	not_revertant	18147910	A	not_revertant	moderate_impact	snv	unknown_function	24.8	no	.	.
tpmt	sg37	124C>G	Q42E	Q42E	missense_variant	.	G	C	18149235	G	not_revertant	18149004	G	not_revertant	moderate_impact	snv	unknown_function	15.39	no	.	.
tpmt	sg38	106G>A	G36S	G36S	missense_variant	rs750424422	C	T	18149253	C	not_revertant	18149022	C	not_revertant	moderate_impact	snv	unknown_function	9.033	no	.	.
tpmt	sg39	83A>T	E28V	E28V	missense_variant	rs72552742	T	A	18149276	T	not_revertant	18149045	T	not_revertant	moderate_impact	snv	unknown_function	29.1	no	.	.
tpmt	sg40	2T>C	M1T	M1T	start_lost	rs267607275	A	G	18149357	A	not_revertant	18149126	A	not_revertant	high_impact	snv	no_function	22.7	yes	.	.
tpmt	sg41	1A>G	M1V	M1V	start_lost	rs9333569	T	C	18149358	T	not_revertant	18149127	T	not_revertant	high_impact	snv	no_function	16.15	yes	.	.
ugt1a1	sg1	.	no_effect	no_effect	upstream_gene_variant	rs28900393	G	A	234664268	G	not_revertant	233755622	G	not_revertant	low_impact	snv	.	1.825	no	.	.
ugt1a1	sg2	.	no_effect	no_effect	upstream_gene_variant	rs13403884	T	G	234664902	T	not_revertant	233756256	T	not_revertant	low_impact	snv	.	0.832	no	.	.
ugt1a1	sg3	-3279T>G	no_effect	no_effect	upstream_gene_variant	rs4124874	T	G	234665659	T	not_revertant	233757013	T	not_revertant	high_impact	snv	decreased_function	6.376	no	.	.
ugt1a1	sg4	.	no_effect	no_effect	upstream_gene_variant	rs1976391	A	G	234665983	A	not_revertant	233757337	A	not_revertant	low_impact	snv	.	5.241	no	.	.
ugt1a1	sg5	-364C>T	promoter	promoter	upstream_gene_variant	rs887829	C	T	234668570	C	not_revertant	233759924	C	not_revertant	low_impact	snv	unknown_function	4.544	no	.	.
ugt1a1	sg6	.	no_effect	no_effect	upstream_gene_variant	rs34547608	T	C	234668828	T	not_revertant	233760182	T	not_revertant	low_impact	snv	.	0.436	no	.	.
ugt1a1	sg7	-64G>C	promoter	promoter	upstream_gene_variant	rs873478	G	C	234668870	G	not_revertant	233760224	G	not_revertant	low_impact	snv	unknown_function	4.525	no	.	.
ugt1a1	sg8	.	promoter	promoter	upstream_gene_variant	rs34983651	CAT	C	234668879	CAT	not_revertant	233760233	CAT	not_revertant	high_impact	indel	increased_function	1.124	no	.	.
ugt1a1	sg9	.	promoter	promoter	upstream_gene_variant	rs34983651	CAT	CATAT	234668879	CAT	not_revertant	233760233	CAT	not_revertant	high_impact	indel	decreased_function	0.239	no	.	.
ugt1a1	sg10	.	promoter	promoter	upstream_gene_variant	rs34983651	CAT	CATATAT	234668879	CAT	not_revertant	233760233	CAT	not_revertant	high_impact	indel	decreased_function	0.226	no	.	.
ugt1a1	sg11	1A>G	M1V	M1V	start_lost	.	A	G	234668934	A	not_revertant	233760288	A	not_revertant	high_impact	snv	no_function	16.74	yes	.	.
ugt1a1	sg12	44T>G	L15R	L15R	missense_variant	rs111033541	T	G	234668977	T	not_revertant	233760331	T	not_revertant	high_impact	snv	decreased_function	22.8	no	.	.
ugt1a1	sg13	101C>A	P34Q	P34Q	missense_variant	.	C	A	234669034	C	not_revertant	233760388	C	not_revertant	high_impact	snv	no_function	25.1	no	.	.
ugt1a1	sg14	111C>A	G37#	G37#	synonymous_variant	rs1018382617	C	A	234669044	C	not_revertant	233760398	C	not_revertant	low_impact	snv	.	14.86	no	.	.
ugt1a1	sg15	115C>G	H39D	H39D	missense_variant	rs72551339	C	G	234669048	C	not_revertant	233760402	C	not_revertant	high_impact	snv	unknown_function	26.4	no	.	.
ugt1a1	sg16	118T>C	W40R	W40R	missense_variant	rs1183811071	T	C	234669051	T	not_revertant	233760405	T	not_revertant	high_impact	snv	no_function	27.5	no	.	.
ugt1a1	sg17	121_122delCT	frameshift	frameshift	frameshift_variant	.	GCT	G	234669053	GCT	not_revertant	233760407	GCT	not_revertant	high_impact	indel	no_function	32	yes	.	.
ugt1a1	sg18	145C>T	Q49X	Q49X	stop_gained	rs587776765	C	T	234669078	C	not_revertant	233760432	C	not_revertant	high_impact	snv	no_function	35	yes	.	.
ugt1a1	sg19	211G>A	G71R	G71R	missense_variant	rs4148323	G	A	234669144	G	not_revertant	233760498	G	not_revertant	high_impact	snv	decreased_function	23.1	no	.	.
ugt1a1	sg20	222C>A	Y74X	Y74X	stop_gained	rs72551340	C	A	234669155	C	not_revertant	233760509	C	not_revertant	high_impact	snv	unknown_function	36	yes	.	.
ugt1a1	sg21	247T>C	F83L	F83L	missense_variant	rs56059937	T	C	234669180	T	not_revertant	233760534	T	not_revertant	moderate_impact	snv	unknown_function	15.55	no	.	.
ugt1a1	sg22	476T>C	I159T	I159T	missense_variant	rs587784539	T	C	234669409	T	not_revertant	233760763	T	not_revertant	moderate_impact	snv	normal_function	26.3	no	.	.
ugt1a1	sg23	511_513delTTC	F171del	F171del	inframe_deletion	rs587776762	CTTC	C	234669443	CTTC	not_revertant	233760797	CTTC	not_revertant	high_impact	indel	no_function	17.9	no	.	.
ugt1a1	sg24	517delC	frameshift	frameshift	frameshift_variant	rs773292758	GC	G	234669449	GC	not_revertant	233760803	GC	not_revertant	high_impact	indel	no_function	14.61	yes	.	.
ugt1a1	sg25	524T>A	L175Q	L175Q	missense_variant	rs72551341	T	A	234669457	T	not_revertant	233760811	T	not_revertant	high_impact	snv	decreased_function	25.2	no	.	.
ugt1a1	sg26	529T>C	C177R	C177R	missense_variant	rs72551342	T	C	234669462	T	not_revertant	233760816	T	not_revertant	high_impact	snv	no_function	25.6	no	.	.
ugt1a1	sg27	554A>C	Q185P	Q185P	missense_variant	.	A	C	234669487	A	not_revertant	233760841	A	not_revertant	high_impact	snv	no_function	24.1	no	.	.
ugt1a1	sg28	576C>G	Y192X	Y192X	stop_gained	rs764242339	C	G	234669509	C	not_revertant	233760863	C	not_revertant	high_impact	snv	no_function	24	yes	.	.
ugt1a1	sg29	625C>T	R209W	R209W	missense_variant	rs72551343	C	T	234669558	C	not_revertant	233760912	C	not_revertant	high_impact	snv	decreased_function	25.7	no	.	.
ugt1a1	sg30	674T>G	V225G	V225G	missense_variant	rs35003977	T	G	234669607	T	not_revertant	233760961	T	not_revertant	moderate_impact	snv	.	10.68	no	.	.
ugt1a1	sg31	686C>A	P229Q	P229Q	missense_variant	rs35350960	C	A	234669619	C	not_revertant	233760973	C	not_revertant	high_impact	snv	decreased_function	13.48	no	.	.
ugt1a1	sg32	698T>G	L233R	L233R	missense_variant	rs72551344	T	G	234669631	T	not_revertant	233760985	T	not_revertant	moderate_impact	snv	unknown_function	24.1	no	.	.
ugt1a1	sg33	722_723delAG	frameshift	frameshift	frameshift_variant	rs797046091	GAG	G	234669654	GAG	not_revertant	233761008	GAG	not_revertant	high_impact	indel	unknown_function	24.3	yes	.	.
ugt1a1	sg34	826G>C	G276R	G276R	missense_variant	rs72551345	G	C	234669759	G	not_revertant	233761113	G	not_revertant	high_impact	snv	no_function	26.8	no	.	.
ugt1a1	sg35	840C>A	C280X	C280X	stop_gained	rs281865418	C	A	234669773	C	not_revertant	233761127	C	not_revertant	high_impact	snv	no_function	34	yes	.	.
ugt1a1	sg36	.	no_effect	no_effect	intron_variant	rs28900398	T	G	234672338	T	not_revertant	233763692	T	not_revertant	low_impact	snv	.	1.003	no	.	.
ugt1a1	sg37	.	no_effect	no_effect	intron_variant	rs4148325	C	T	234673309	C	not_revertant	233764663	C	not_revertant	low_impact	snv	.	2.807	no	.	.
ugt1a1	sg38	.	no_effect	no_effect	intron_variant	rs4663334	C	T	234674924	C	not_revertant	233766278	C	not_revertant	low_impact	snv	.	0.301	no	ugt1a1,ugt1a4	.
ugt1a1	sg39	.	splicing_defect	splicing_defect	splice_acceptor_variant	rs1285708223	G	A	234675679	G	not_revertant	233767033	G	not_revertant	high_impact	snv	no_function	34	yes	.	.
ugt1a1	sg40	875C>T	A292V	A292V	missense_variant	rs758873309	C	T	234675690	C	not_revertant	233767044	C	not_revertant	high_impact	snv	no_function	24.5	no	.	.
ugt1a1	sg41	877_889delTACATTAATGCTT	frameshift	frameshift	frameshift_variant	rs1383060097	CTACATTAATGCTT	C	234675691	CTACATTAATGCTT	not_revertant	233767045	CTACATTAATGCTT	not_revertant	high_impact	indel	no_function	35	yes	.	.
ugt1a1	sg42	881T>C	I294T	I294T	missense_variant	rs72551347	T	C	234675696	T	not_revertant	233767050	T	not_revertant	high_impact	snv	decreased_function	22.9	no	.	.
ugt1a1	sg43	923G>A	G308E	G308E	missense_variant	rs62625011	G	A	234675738	G	not_revertant	233767092	G	not_revertant	high_impact	snv	no_function	29	no	.	.
ugt1a1	sg44	928A>G	M310V	M310V	missense_variant	.	A	G	234675743	A	not_revertant	233767097	A	not_revertant	high_impact	snv	decreased_function	23.1	no	.	.
ugt1a1	sg45	962C>G	A321G	A321G	missense_variant	.	C	G	234675777	C	not_revertant	233767131	C	not_revertant	moderate_impact	snv	normal_function	17.09	no	.	.
ugt1a1	sg46	964A>G	I322V	I322V	missense_variant	rs200903749	A	G	234675779	A	not_revertant	233767133	A	not_revertant	moderate_impact	snv	normal_function	24.9	no	.	.
ugt1a1	sg47	973delG	frameshift	frameshift	frameshift_variant	.	TG	T	234675787	TG	not_revertant	233767141	TG	not_revertant	high_impact	indel	no_function	35	yes	.	.
ugt1a1	sg48	991C>T	Q331X	Q331X	stop_gained	rs111033539	C	T	234675806	C	not_revertant	233767160	C	not_revertant	high_impact	snv	no_function	43	yes	.	.
ugt1a1	sg49	992A>G	Q331R	Q331R	missense_variant	rs72551348	A	G	234675807	A	not_revertant	233767161	A	not_revertant	high_impact	snv	decreased_function	27.2	no	.	.
ugt1a1	sg50	.	no_effect	no_effect	intron_variant	rs34650714	C	T	234675829	C	not_revertant	233767183	C	not_revertant	low_impact	snv	.	0.723	no	.	.
ugt1a1	sg51	.	no_effect	no_effect	intron_variant	rs1018124	A	G	234676118	A	not_revertant	233767472	A	not_revertant	low_impact	snv	.	1.545	no	ugt1a1,ugt1a4	.
ugt1a1	sg52	1005G>A	W335X	W335X	stop_gained	.	G	A	234676503	G	not_revertant	233767857	G	not_revertant	high_impact	snv	no_function	48	yes	.	.
ugt1a1	sg53	1006C>T	R336W	R336W	missense_variant	rs139607673	C	T	234676504	C	not_revertant	233767858	C	not_revertant	high_impact	snv	no_function	26.3	no	.	.
ugt1a1	sg54	1007G>A	R336Q	R336Q	missense_variant	rs750453538	G	A	234676505	G	not_revertant	233767859	G	not_revertant	high_impact	snv	no_function	32	no	.	.
ugt1a1	sg55	1007G>T	R336L	R336L	missense_variant	rs750453538	G	T	234676505	G	not_revertant	233767859	G	not_revertant	high_impact	snv	no_function	32	no	.	.
ugt1a1	sg56	1021C>T	R341X	R341X	stop_gained	rs72551349	C	T	234676519	C	not_revertant	233767873	C	not_revertant	high_impact	snv	no_function	35	yes	.	.
ugt1a1	sg57	1043delA	frameshift	frameshift	frameshift_variant	rs745655794	CA	C	234676539	CA	not_revertant	233767893	CA	not_revertant	high_impact	indel	no_function	34	yes	.	.
ugt1a1	sg58	1060T>C	W354R	W354R	missense_variant	.	T	C	234676558	T	not_revertant	233767912	T	not_revertant	high_impact	snv	no_function	31	no	.	.
ugt1a1	sg59	1069C>T	Q357X	Q357X	stop_gained	rs72551350	C	T	234676567	C	not_revertant	233767921	C	not_revertant	high_impact	snv	no_function	51	yes	.	.
ugt1a1	sg60	1070A>G	Q357R	Q357R	missense_variant	rs72551351	A	G	234676568	A	not_revertant	233767922	A	not_revertant	high_impact	snv	no_function	30	no	.	.
ugt1a1	sg61	1075G>A	D359N	D359N	missense_variant	rs267599273	G	A	234676573	G	not_revertant	233767927	G	not_revertant	high_impact	snv	normal_function	33	no	.	.
ugt1a1	sg62	.	splicing_defect	splicing_defect	splice_donor_variant	rs587784535	G	A	234676583	G	not_revertant	233767937	G	not_revertant	high_impact	snv	no_function	34	yes	.	.
ugt1a1	sg63	.	splicing_defect	splicing_defect	splice_donor_variant	rs587784535	G	T	234676583	G	not_revertant	233767937	G	not_revertant	high_impact	snv	no_function	34	yes	.	.
ugt1a1	sg64	1091C>T	P364L	P364L	missense_variant	rs34946978	C	T	234676872	C	not_revertant	233768226	C	not_revertant	high_impact	snv	decreased_function	29.2	no	ugt1a1,ugt1a4	.
ugt1a1	sg65	1099C>G	R367G	R367G	missense_variant	rs55750087	C	G	234676880	C	not_revertant	233768234	C	not_revertant	high_impact	snv	decreased_function	23.6	no	.	.
ugt1a1	sg66	1102G>A	A368T	A368T	missense_variant	rs72551352	G	A	234676883	G	not_revertant	233768237	G	not_revertant	high_impact	snv	no_function	30	no	.	.
ugt1a1	sg67	1124C>T	S375F	S375F	missense_variant	rs72551353	C	T	234676905	C	not_revertant	233768259	C	not_revertant	high_impact	snv	no_function	32	no	.	.
ugt1a1	sg68	1127A>G	H376R	H376R	missense_variant	rs1349037761	A	G	234676908	A	not_revertant	233768262	A	not_revertant	high_impact	snv	no_function	26.3	no	.	.
ugt1a1	sg69	1130G>T	G377V	G377V	missense_variant	rs1283652721	G	T	234676911	G	not_revertant	233768265	G	not_revertant	high_impact	snv	no_function	28.7	no	.	.
ugt1a1	sg70	1143C>G	S381R	S381R	missense_variant	rs72551354	C	G	234676924	C	not_revertant	233768278	C	not_revertant	high_impact	snv	no_function	17.1	no	.	.
ugt1a1	sg71	1159C>T	P387S	P387S	missense_variant	rs901936528	C	T	234676940	C	not_revertant	233768294	C	not_revertant	high_impact	snv	no_function	27.3	no	.	.
ugt1a1	sg72	1160C>G	P387R	P387R	missense_variant	.	C	G	234676941	C	not_revertant	233768295	C	not_revertant	high_impact	snv	no_function	27.7	no	.	.
ugt1a1	sg73	1161C>T	P387#	P387#	synonymous_variant	rs763217521	C	T	234676942	C	not_revertant	233768296	C	not_revertant	low_impact	snv	.	2.044	no	.	.
ugt1a1	sg74	1184G>T	G395V	G395V	missense_variant	rs367897068	G	T	234676965	G	not_revertant	233768319	G	not_revertant	high_impact	snv	no_function	27	no	.	.
ugt1a1	sg75	1186delG	frameshift	frameshift	frameshift_variant	.	TG	T	234676966	TG	not_revertant	233768320	TG	not_revertant	high_impact	indel	no_function	35	yes	.	.
ugt1a1	sg76	1198A>G	N400D	N400D	missense_variant	rs28934877	A	G	234676979	A	not_revertant	233768333	A	not_revertant	moderate_impact	snv	unknown_function	29.7	no	.	.
ugt1a1	sg77	1201G>C	A401P	A401P	missense_variant	rs72551355	G	C	234676982	G	not_revertant	233768336	G	not_revertant	high_impact	snv	no_function	26	no	.	.
ugt1a1	sg78	1207C>T	R403C	R403C	missense_variant	rs778766461	C	T	234676988	C	not_revertant	233768342	C	not_revertant	high_impact	snv	no_function	32	no	.	.
ugt1a1	sg79	1220delA	frameshift	frameshift	frameshift_variant	rs558109660	TA	T	234676999	TA	not_revertant	233768353	TA	not_revertant	high_impact	indel	no_function	26.7	yes	.	.
ugt1a1	sg80	1223insG	frameshift	frameshift	frameshift_variant	rs758192306	A	AG	234677001	A	not_revertant	233768355	A	not_revertant	high_impact	indel	no_function	26.8	yes	.	.
ugt1a1	sg81	1282A>G	K428E	K428E	missense_variant	rs72551356	A	G	234677063	A	not_revertant	233768417	A	not_revertant	high_impact	snv	no_function	25.1	no	.	.
ugt1a1	sg82	1292T>C	I431T	I431T	missense_variant	.	T	C	234677073	T	not_revertant	233768427	T	not_revertant	high_impact	snv	decreased_function	29.2	no	.	.
ugt1a1	sg83	1309A>T	K437X	K437X	stop_gained	rs72551357	A	T	234680912	A	not_revertant	233772266	A	not_revertant	high_impact	snv	no_function	37	yes	.	.
ugt1a1	sg84	1381T>C	W461R	W461R	missense_variant	rs1476500325	T	C	234680984	T	not_revertant	233772338	T	not_revertant	high_impact	snv	no_function	33	no	.	.
ugt1a1	sg85	1388A>C	E463A	E463A	missense_variant	rs72551358	A	C	234680991	A	not_revertant	233772345	A	not_revertant	high_impact	snv	unknown_function	32	no	.	.
ugt1a1	sg86	.	E463D	E463D	missense_variant	rs115944950	G	C	234680992	G	not_revertant	233772346	G	not_revertant	moderate_impact	snv	.	24.6	no	ugt1a1,ugt1a4	.
ugt1a1	sg87	1433C>A	A478D	A478D	missense_variant	.	C	A	234681036	C	not_revertant	233772390	C	not_revertant	high_impact	snv	no_function	32	no	.	.
ugt1a1	sg88	1448G>A	W483X	W483X	stop_gained	rs1176419046	G	A	234681051	G	not_revertant	233772405	G	not_revertant	high_impact	snv	no_function	47	yes	.	.
ugt1a1	sg89	1449G>A	W483X	W483X	stop_gained	rs866632307	G	A	234681052	G	not_revertant	233772406	G	not_revertant	high_impact	snv	unknown_function	50	yes	.	.
ugt1a1	sg90	1456T>G	Y486D	Y486D	missense_variant	rs34993780	T	G	234681059	T	not_revertant	233772413	T	not_revertant	high_impact	snv	decreased_function	29.8	no	.	.
ugt1a1	sg91	1477G>C	G493R	G493R	missense_variant	.	G	C	234681080	G	not_revertant	233772434	G	not_revertant	high_impact	snv	no_function	29.5	no	.	.
ugt1a1	sg92	1487T>A	L496X	L496X	stop_gained	234681090	T	A	234681090	T	not_revertant	233772444	T	not_revertant	high_impact	snv	no_function	43	yes	.	.
ugt1a1	sg93	1598A>C	H533P	H533P	missense_variant	rs1350310639	A	C	234681201	A	not_revertant	233772555	A	not_revertant	moderate_impact	snv	unknown_function	21.9	no	.	.
ugt1a1	sg94	.	no_effect	no_effect	3_prime_UTR_variant	rs10929303	T	C	234681416	T	not_revertant	233772770	T	not_revertant	low_impact	snv	.	2.314	no	ugt1a1,ugt1a4	.
ugt1a1	sg95	.	no_effect	no_effect	3_prime_UTR_variant	rs1042640	G	C	234681544	G	not_revertant	233772898	G	not_revertant	low_impact	snv	.	0.069	no	ugt1a1,ugt1a4	.
ugt1a1	sg96	2042C>G	no_effect	no_effect	3_prime_UTR_variant	rs8330	G	C	234681645	G	not_revertant	233772999	G	not_revertant	low_impact	snv	unknown_function	5.947	no	ugt1a1,ugt1a4	.
ugt1a1	sg97	.	no_effect	no_effect	downstream_gene_variant	rs4148329	C	T	234682062	C	not_revertant	233773416	C	not_revertant	low_impact	snv	.	0.331	no	ugt1a1,ugt1a4	.
ugt1a1	sg98	.	no_effect	no_effect	downstream_gene_variant	rs6717546	A	G	234682119	A	not_revertant	233773473	A	not_revertant	low_impact	snv	.	2.544	no	ugt1a1,ugt1a4	.
ugt1a4	sg1	-1824G>A	no_effect	no_effect	upstream_gene_variant	rs28898606	G	A	234625643	G	not_revertant	233716997	G	not_revertant	low_impact	snv	.	3.364	no	.	.
ugt1a4	sg2	-811G>A	no_effect	no_effect	upstream_gene_variant	rs28898608	G	A	234626656	G	not_revertant	233718010	G	not_revertant	low_impact	snv	.	1.994	no	.	.
ugt1a4	sg3	-217T>G	no_effect	no_effect	upstream_gene_variant	.	T	G	234627246	A	not_revertant	233718600	A	not_revertant	low_impact	snv	.	3.454	no	.	.
ugt1a4	sg4	-219C>T	no_effect	no_effect	upstream_gene_variant	rs3732219	C	T	234627248	C	not_revertant	233718602	C	not_revertant	low_impact	snv	.	1.827	no	.	.
ugt1a4	sg5	-163G>A	no_effect	no_effect	upstream_gene_variant	rs3732218	G	A	234627304	G	not_revertant	233718658	G	not_revertant	low_impact	snv	.	2.199	no	.	.
ugt1a4	sg6	-36G>A	no_effect	no_effect	upstream_gene_variant	rs544842461	G	A	234627431	G	not_revertant	233718785	G	not_revertant	low_impact	snv	.	5.574	no	.	.
ugt1a4	sg7	30G>A	P10#	P10#	synonymous_variant	.	G	A	234627496	G	not_revertant	233718850	G	not_revertant	low_impact	snv	.	0.858	no	.	.
ugt1a4	sg8	31C>T	R11W	R11W	missense_variant	rs3892221	C	T	234627497	C	not_revertant	233718851	C	not_revertant	moderate_impact	snv	unknown_function	5.322	no	.	.
ugt1a4	sg9	70C>A	P24T	P24T	missense_variant	rs6755571	C	A	234627536	C	not_revertant	233718890	C	not_revertant	moderate_impact	snv	unknown_function	3.834	no	.	.
ugt1a4	sg10	127delA	frameshift	frameshift	frameshift_variant	.	CA	C	234627592	CA	not_revertant	233718946	CA	not_revertant	high_impact	indel	unknown_function	24.4	yes	.	.
ugt1a4	sg11	142T>G	L48V	L48V	missense_variant	rs2011425	T	G	234627608	T	not_revertant	233718962	T	not_revertant	high_impact	snv	decreased_function	5.282	no	.	.
ugt1a4	sg12	175delG	frameshift	frameshift	frameshift_variant	rs141408391	CG	C	234627639	CG	not_revertant	233718993	CG	not_revertant	high_impact	indel	unknown_function	7.789	yes	.	.
ugt1a4	sg13	271C>T	R91C	R91C	missense_variant	rs183802414	C	T	234627737	C	not_revertant	233719091	C	not_revertant	moderate_impact	snv	.	15.62	no	.	.
ugt1a4	sg14	.	Q98X	Q98X	stop_gained	rs201323245	C	T	234627758	C	not_revertant	233719112	C	not_revertant	high_impact	snv	unknown_function	35	yes	.	.
ugt1a4	sg15	325A>G	R109G	R109G	missense_variant	rs539093785	A	G	234627791	A	not_revertant	233719145	A	not_revertant	moderate_impact	snv	.	9.896	no	.	.
ugt1a4	sg16	357T>C	N119#	N119#	synonymous_variant	rs779768748	T	C	234627823	T	not_revertant	233719177	T	not_revertant	low_impact	snv	.	0.782	no	.	.
ugt1a4	sg17	448T>C	L150#	L150#	synonymous_variant	rs12468274	T	C	234627914	T	not_revertant	233719268	T	not_revertant	low_impact	snv	.	2.671	no	.	.
ugt1a4	sg18	471C>T	C157#	C157#	synonymous_variant	rs2011404	C	T	234627937	T	revertant	233719291	T	revertant	low_impact	snv	.	1.402	no	.	.
ugt1a4	sg19	804G>A	P268#	P268#	synonymous_variant	rs3732217	G	A	234628270	G	not_revertant	233719624	G	not_revertant	low_impact	snv	.	12.69	no	.	.
ugt1a4	sg20	IVS1+1G>T	splicing_defect	splicing_defect	splice_donor_variant	rs562977700	G	T	234628334	G	not_revertant	233719688	G	not_revertant	high_impact	snv	unknown_function	22.7	yes	.	.
ugt1a4	sg21	IVS1+43C>T	no_effect	no_effect	intron_variant	rs2011219	C	T	234628376	C	not_revertant	233719730	C	not_revertant	low_impact	snv	.	3.514	no	.	.
ugt1a4	sg22	IVS1+98A>G	no_effect	no_effect	intron_variant	.	A	G	234628431	A	not_revertant	233719785	A	not_revertant	low_impact	snv	.	4.059	no	.	.
ugt1a4	sg23	IVS1+101G>T	no_effect	no_effect	intron_variant	rs184331208	G	T	234628434	G	not_revertant	233719788	G	not_revertant	low_impact	snv	.	0.223	no	.	.
ugt1a4	sg24	IVS1+1493C>A	no_effect	no_effect	intron_variant	rs28898614	C	A	234629826	C	not_revertant	233721180	C	not_revertant	low_impact	snv	.	0.489	no	.	.
ugt1a4	sg25	.	no_effect	no_effect	intron_variant	rs4663334	C	T	234674924	C	not_revertant	233766278	C	not_revertant	low_impact	snv	.	0.301	no	ugt1a1,ugt1a4	.
ugt1a4	sg26	.	no_effect	no_effect	intron_variant	rs1018124	A	G	234676118	A	not_revertant	233767472	A	not_revertant	low_impact	snv	.	1.545	no	ugt1a1,ugt1a4	.
ugt1a4	sg27	.	P365L	P365L	missense_variant	rs34946978	C	T	234676872	C	not_revertant	233768226	C	not_revertant	moderate_impact	snv	.	29.2	no	ugt1a1,ugt1a4	.
ugt1a4	sg28	.	no_effect	no_effect	intron_variant	rs6431630	G	A	234677386	G	not_revertant	233768740	G	not_revertant	low_impact	snv	.	0.364	no	.	.
ugt1a4	sg29	.	no_effect	no_effect	intron_variant	rs11563251	C	T	234679384	C	not_revertant	233770738	C	not_revertant	low_impact	snv	.	3.16	no	.	.
ugt1a4	sg30	.	no_effect	no_effect	intron_variant	rs35203651	T	C	234679549	T	not_revertant	233770903	T	not_revertant	low_impact	snv	.	5.777	no	.	.
ugt1a4	sg31	.	no_effect	no_effect	intron_variant	rs11888492	C	G	234679974	C	not_revertant	233771328	C	not_revertant	low_impact	snv	.	1.459	no	.	.
ugt1a4	sg32	.	E463D	E463D	missense_variant	rs115944950	G	C	234680992	G	not_revertant	233772346	G	not_revertant	moderate_impact	snv	.	24.6	no	ugt1a1,ugt1a4	.
ugt1a4	sg33	.	no_effect	no_effect	3_prime_UTR_variant	rs10929303	T	C	234681416	T	not_revertant	233772770	T	not_revertant	low_impact	snv	.	2.314	no	ugt1a1,ugt1a4	.
ugt1a4	sg34	.	no_effect	no_effect	3_prime_UTR_variant	rs1042640	G	C	234681544	G	not_revertant	233772898	G	not_revertant	low_impact	snv	.	0.069	no	ugt1a1,ugt1a4	.
ugt1a4	sg35	.	no_effect	no_effect	3_prime_UTR_variant	rs8330	G	C	234681645	G	not_revertant	233772999	G	not_revertant	low_impact	snv	.	5.947	no	ugt1a1,ugt1a4	.
ugt1a4	sg36	.	no_effect	no_effect	downstream_gene_variant	rs4148329	C	T	234682062	C	not_revertant	233773416	C	not_revertant	low_impact	snv	.	0.331	no	ugt1a1,ugt1a4	.
ugt1a4	sg37	.	no_effect	no_effect	downstream_gene_variant	rs6717546	A	G	234682119	A	not_revertant	233773473	A	not_revertant	low_impact	snv	.	2.544	no	ugt1a1,ugt1a4	.
ugt2b7	sg1	211G>T	A71S	A71S	missense_variant	rs12233719	G	T	69962449	G	not_revertant	69096731	G	not_revertant	moderate_impact	snv	unknown_function	0.003	no	.	.
ugt2b7	sg2	802C>T	H268Y	H268Y	missense_variant	rs7439366	C	T	69964338	T	revertant	69098620	T	revertant	moderate_impact	snv	unknown_function	12.88	no	.	.
ugt2b7	sg3	1192G>A	D398N	D398N	missense_variant	rs776991562	G	A	69973922	G	not_revertant	69108204	G	not_revertant	moderate_impact	snv	unknown_function	23.5	no	.	.
ugt2b15	sg1	1568A>C	K523T	K523T	missense_variant	rs4148269	T	G	69512847	T	not_revertant	68647129	T	not_revertant	moderate_impact	snv	unknown_function	1.622	no	.	.
ugt2b15	sg2	.	R518X	R518X	stop_gained	rs143480699	G	A	69512863	G	not_revertant	68647145	G	not_revertant	high_impact	snv	unknown_function	37	yes	.	.
ugt2b15	sg3	1055C>T	T352I	T352I	missense_variant	rs148583958	G	A	69520851	G	not_revertant	68655133	G	not_revertant	moderate_impact	snv	unknown_function	23.8	no	.	.
ugt2b15	sg4	256T>C	L86S	L86S	missense_variant	rs368012995	A	G	69536080	A	not_revertant	68670362	A	not_revertant	moderate_impact	snv	unknown_function	12.39	no	.	.
ugt2b15	sg5	253G>T	D85Y	D85Y	missense_variant	rs1902023	C	A	69536084	A	revertant	68670366	A	revertant	moderate_impact	snv	unknown_function	7.489	no	.	.
vkorc1	sg1	9041G>A	no_effect	no_effect	3_prime_UTR_variant	rs7294	C	T	31102321	C	not_revertant	31091000	C	not_revertant	low_impact	snv	unknown_function	3.208	no	.	.
vkorc1	sg2	.	L128R	L128R	missense_variant	rs104894542	A	C	31102564	A	not_revertant	31091243	A	not_revertant	high_impact	snv	unknown_function	31	no	.	.
vkorc1	sg3	7566C>T	no_effect	no_effect	intron_variant	rs2359612	G	A	31103796	A	revertant	31092475	A	revertant	low_impact	snv	.	6.613	no	.	.
vkorc1	sg4	.	V66M	V66M	missense_variant	rs72547529	C	T	31104720	C	not_revertant	31093399	C	not_revertant	moderate_impact	snv	unknown_function	29.7	no	.	.
vkorc1	sg5	6484C>T	no_effect	no_effect	intron_variant	rs9934438	G	A	31104878	G	not_revertant	31093557	G	not_revertant	low_impact	snv	.	11.64	no	.	.
vkorc1	sg6	6009C>T	no_effect	no_effect	intron_variant	rs17708472	G	A	31105353	G	not_revertant	31094032	G	not_revertant	low_impact	snv	unknown_function	8.333	no	.	.
vkorc1	sg7	.	R58G	R58G	missense_variant	rs104894541	T	C	31105879	T	not_revertant	31094558	T	not_revertant	moderate_impact	snv	unknown_function	24.3	no	.	.
vkorc1	sg8	.	V45A	V45A	missense_variant	rs104894540	A	G	31105917	A	not_revertant	31094596	A	not_revertant	moderate_impact	snv	unknown_function	24.7	no	.	.
vkorc1	sg9	.	A41S	A41S	missense_variant	.	C	A	31105930	C	not_revertant	31094609	C	not_revertant	moderate_impact	snv	unknown_function	26.8	no	.	.
vkorc1	sg10	.	V29L	V29L	missense_variant	rs104894539	C	A	31105966	C	not_revertant	31094645	C	not_revertant	moderate_impact	snv	unknown_function	27.5	no	.	.
vkorc1	sg11	-1639G>A	promoter	promoter	upstream_gene_variant	rs9923231	C	T	31107689	C	not_revertant	31096368	C	not_revertant	high_impact	snv	.	2.497	no	.	.
xpc	sg1	2815C>A	Q939K	Q939K	missense_variant	rs2228001	G	T	14187449	G	not_revertant	14145949	G	not_revertant	moderate_impact	snv	unknown_function	18.95	no	.	.
xpc	sg2	1496C>T	A499V	A499V	missense_variant	rs2228000	G	A	14199887	G	not_revertant	14158387	G	not_revertant	moderate_impact	snv	unknown_function	1.528	no	.	.
