Metadata-Version: 2.1
Name: crockode
Version: 0.1.1
Summary: A packagees into DNA, RNA or protein sequences.
License: MIT
Author: Michela Palamin, Simone Procaccia, Erin Chung, Joshua Talks
Requires-Python: >=3.9,<4.0
Classifier: License :: OSI Approved :: MIT License
Classifier: Programming Language :: Python :: 3
Classifier: Programming Language :: Python :: 3.9
Classifier: Programming Language :: Python :: 3.10
Classifier: Programming Language :: Python :: 3.11
Classifier: Programming Language :: Python :: 3.12
Description-Content-Type: text/markdown

# crockode

`crockode` is a python package for encoding a string message into a DNA sequence and decoding .

## Installation

```bash
$ pip install crockode
```

## Usage

```python
import crockode

# returns 'GCCAGCGGGCTAGCTAGCTT'
crockode.encode_string('hello')

# returns 'hello'
crockode.decode_DNA('GCCAGCGGGCTAGCTAGCTT')
```

## Contributing

Interested in contributing? Check out the contributing guidelines. Please note that this project is released with a Code of Conduct. By contributing to this project, you agree to abide by its terms.

## License

`crockode` was created by Michela Palamin, Simone Procaccia, Erin Chung, Joshua Talks. It is licensed under the terms of the MIT license.

## Credits

`crockode` was created with [`cookiecutter`](https://cookiecutter.readthedocs.io/en/latest/) and the `py-pkgs-cookiecutter` [template](https://github.com/py-pkgs/py-pkgs-cookiecutter).


## Project status

The creators have run out of time, energy, and motivation to develop this project. Rest In Peace `crockode` 05/02/2024-09/02/2024. 
