Metadata-Version: 1.0
Name: dna_features_viewer
Version: 0.1.6
Summary: Plot features from DNA sequences (e.g. Genbank) with Python
Home-page: UNKNOWN
Author: Zulko
Author-email: UNKNOWN
License: see LICENSE.txt
Description: .. raw:: html
        
            <p align="center">
            <img alt="DNA Features Viewer Logo" title="DNA Features Viewer Logo" src="https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/docs/title.png" width="350">
            </p>
        
        .. image:: https://travis-ci.org/Edinburgh-Genome-Foundry/DnaFeaturesViewer.svg?branch=master
           :target: https://travis-ci.org/Edinburgh-Genome-Foundry/DnaFeaturesViewer
           :alt: Travis CI build status
        
        .. image:: https://coveralls.io/repos/github/Edinburgh-Genome-Foundry/DnaFeaturesViewer/badge.svg?branch=master
           :target: https://coveralls.io/github/Edinburgh-Genome-Foundry/DnaFeaturesViewer?branch=master
        
        
        DNA Features Viewer is a Python library to visualize DNA features, e.g. from GenBank or Gff files:
        
        .. raw:: html
        
            <p align="center">
            <img src="https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/examples/by_hand.png" width="500">
            </p>
        
        Dna Features Viewer is meant to automatically produce simple and clear plots even
        for sequences with lots of overlapping features and long labels. It plays well with Matplotlib and Biopython.
        The plots can be output to many different formats (PNG, JPEG, SVG, PDF), e.g.
        for report generation or LIMS interfaces.
        
        
        License
        ---------
        
        Dna Features Viewer is an open-source software originally written at the `Edinburgh Genome Foundry
        <http://genomefoundry.org>`_ by `Zulko <https://github.com/Zulko>`_
        and `released on Github <https://github.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer>`_ under the MIT licence.
        Everyone is welcome to contribute !
        
        Installation
        --------------
        
        If you have PIP installed, just type in a terminal:
        
        .. code:: python
        
            (sudo) pip install dna_features_viewer
        
        Dna Features Viewer can be installed by unzipping the source code in one directory and using this command:
        
        .. code:: python
        
            sudo python setup.py install
        
        If you intend to use the bokeh features, you need to also install Bokeh and Pandas:
        
        .. code:: python
        
            (sudo) pip install bokeh pandas
        
        
        Examples of use
        ----------------
        
        
        Basic plots
        ~~~~~~~~~~~~
        
        In this first example we define features "by hand":
        
        .. code:: python
        
            from dna_features_viewer import GraphicFeature, GraphicRecord
            features=[
                GraphicFeature(start=0, end=20, strand=+1, color="#ffd700",
                               label="Small feature"),
                GraphicFeature(start=20, end=500, strand=+1, color="#ffcccc",
                               label="Gene 1 with a very long name"),
                GraphicFeature(start=400, end=700, strand=-1, color="#cffccc",
                               label="Gene 2"),
                GraphicFeature(start=600, end=900, strand=+1, color="#ccccff",
                               label="Gene 3")
            ]
            record = GraphicRecord(sequence_length=1000, features=features)
            record.plot(figure_width=5)
        
        .. raw:: html
        
            <p align="center">
            <img src="https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/examples/by_hand.png" width="500">
            </p>
        
        
        If we replace `GraphicRecord` by `CircularGraphicRecord` in the code above we obtain
        a circular plot of the construct:
        
        .. raw:: html
        
            <p align="center">
            <img src="https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/examples/by_hand_circular.png" width="443">
            </p>
        
        It is also possible to generate interactive (browser-based) plots by using ``plot_with_bokeh`` instead of ``plot``:
        
        .. raw:: html
        
            <p align="center">
            <img src="https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/examples/plot_with_bokeh.png" width="800">
            </p>
        
        Nucleotide sequences, translations, and cropping
        ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
        
        DNA features viewer allows to plot nucleotide or amino acid sequences under
        the record plot:
        
        .. code:: python
        
            from dna_features_viewer import GraphicFeature, GraphicRecord
        
            sequence = "ATGCATGCATGCATGCATGCATGCATGC"
            record = GraphicRecord(sequence, features=[
                GraphicFeature(start=5, end=10, strand=+1, color='#ffcccc'),
                GraphicFeature(start=8, end=15, strand=+1, color='#ccccff')
            ])
        
            ax, _ = record.plot(figure_width=5)
            record.plot_sequence(ax)
            record.plot_translation(ax, (8, 23), fontdict={'weight': 'bold'})
            ax.figure.savefig('sequence_and_translation.png', bbox_inches='tight')
        
        .. raw:: html
        
            <p align="center">
            <img src="https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/examples/sequence_and_translation.png" width="415">
            </p>
        
        This enables for instance to plot an overview of a sequence along with a detailed detail of a sequence subsegment (`full code <https://github.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/blob/master/examples/overview_and_detail.py>`_)
        
        .. code:: python
        
            ...
            record.plot(ax=ax1)
            cropped_record = record.crop((zoom_start, zoom_end))
            cropped_record.plot(ax=ax2)
            cropped_record.plot_sequence(ax=ax2)
            cropped_record.plot_translation(ax=ax2, location=(408, 423))
        
        .. raw:: html
        
            <p align="center">
            <img src="https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/examples/overview_and_detail.png" width="900">
            </p>
        
        
        Reading the features from a GenBank file
        ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
        
        DnaFeaturesViewer plays nice with BioPython. As a result it is super easy to plot the content of a Biopython record or directly a GenBank file:
        
        .. code:: python
        
            from dna_features_viewer import BiopythonTranslator
            graphic_record = BiopythonTranslator().translate_record("my_sequence.gb")
            ax, _ = graphic_record.plot(figure_width=10)
        
        .. raw:: html
        
            <p align="center">
            <img src="https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/examples/from_genbank.png" width="900">
            </p>
        
        The class ``BiopythonTranslator`` determines how the genbank information is transformed into graphical features.
        It enables to chose which categories of features to plot, the color of the different features.
        
        Displaying the features along with other plots
        ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
        
        As it uses Matplotlib, Dna Features Viewer can display the features on top of
        other sequences statistics, such as the local GC content:
        
        .. code:: python
        
            import matplotlib.pyplot as plt
            from dna_features_viewer import BiopythonTranslator
            from Bio import SeqIO
            import numpy as np
        
            fig, (ax1, ax2) = plt.subplots(2, 1, figsize=(8, 4), sharex=True)
        
            # Parse the genbank file, plot annotations
            record = SeqIO.read("example_sequence.gb", "genbank")
            graphic_record = BiopythonTranslator().translate_record(record)
            ax, levels = graphic_record.plot()
            graphic_record.plot(ax=ax1, with_ruler=False)
        
            # Plot the local GC content
            def plot_local_gc_content(record, window_size, ax):
                gc_content = lambda s: 100.0*len([c for c in s if c in "GC"]) / len(s)
                yy = [gc_content(record.seq[i:i+window_size])
                      for i in range(len(record.seq)-window_size)]
                xx = np.arange(len(record.seq)-window_size)+25
                ax.fill_between(xx, yy, alpha=0.3)
                ax.set_ylabel("GC(%)")
        
            plot_local_gc_content(record, window_size=50, ax=ax2)
        
            # Resize the figure
            fig.savefig("with_plot.png")
        
        
        .. raw:: html
        
            <p align="center">
            <img src="https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/examples/with_plot.png" width="800">
            </p>
        
        .. figure::
            :align: center
        
        Custom biopython translators
        ----------------------------
        
        Dna Features Viewer allows to define "themes" by using custom record translators
        instead of the default ``BiopythonTranslator``. Here is an example:
        
        .. code:: python
        
            from dna_features_viewer import BiopythonTranslator
        
            class MyCustomTranslator(BiopythonTranslator):
                """Custom translator implementing the following theme:
        
                - Color terminators in green, CDS in blue, all other features in gold.
                - Do not display features that are restriction sites unless they are BamHI
                - Do not display labels for restriction sites
                - For CDS labels just write "CDS here" instead of the name of the gene.
        
                """
        
                def compute_feature_color(self, feature):
                    if feature.type == "CDS":
                        return "blue"
                    elif feature.type == "terminator":
                        return "green"
                    else:
                        return "gold"
        
                def compute_feature_label(self, feature):
                    if feature.type == 'restriction_site':
                        return None
                    elif feature.type == "CDS":
                        return "CDS here"
                    else:
                        return BiopythonTranslator.compute_feature_label(feature)
        
                def compute_filtered_features(self, features):
                    """Do not display promoters. Just because."""
                    return [
                        feature for feature in features
                        if (feature.type != "restriction_site")
                        or ("BamHI" in str(feature.qualifiers.get("label", '')))
                    ]
        
        
            graphic_record = MyCustomTranslator().translate_record("example_sequence.gb")
            ax, _ = graphic_record.plot(figure_width=10)
            ax.figure.tight_layout()
            ax.figure.savefig("custom_bopython_translator.png")
        
        .. figure:: https://raw.githubusercontent.com/Edinburgh-Genome-Foundry/DnaFeaturesViewer/master/examples/custom_biopython_translator.png
            :align: center
        
Keywords: DNA Sequence Feature Genbank Biopython Matplotlib
Platform: UNKNOWN
